DNASU Plasmid Repository • 480.965.5697 | Email

CYTH4 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CYTH4
Gene Name:  cytohesin 4
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100000504)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00350513

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1185nts         Open reading frame : 1 to 1185
Reference Sequence Alignment

ATGGACCTGTGCCACCCAGAGCCCGCGGAGCTGAGCAGCGGGGAGACGGAAGAGTTACAG
AGGATCAAGTGGCACCGAAAGCAGCTCCTGGAGGACATCCAGAAGCTGAAGGATGAGATT
GCAGATGTGTTTGCCCAAATCGACTGCTTCGAGAGTGCGGAGGAGAGCCGGATGGCCCAG
AAGGAGAAGGAGCTGTGTATTGGGCGCAAGAAGTTCAACATGGACCCCGCCAAGGGTATC
CAGTATTTCATTGAGCACAAGCTGCTGACCCCTGACGTCCAGGACATTGCACGGTTCCTG
TATAAAGGCGAGGGCCTCAACAAGACAGCCATTGGTACCTACCTGGGGGAGAGGGATCCC
ATCAACCTGCAGGTCCTCCAGGCCTTCGTGGACTGCCACGAGTTCGCCAACCTCAACCTC
GTCCAGGCCCTCAGGCAGTTCCTGTGGAGCTTCCGGCTGCCGGGCGAGGCCCAGAAGATA
GACCGGATGATGGAGGCCTTTGCCACTCGATACTGCCTCTGCAACCCAGGCGTCTTCCAG
TCCACAGACACCTGCTACGTGTTGTCCTTCTCCATCATCATGCTCAACACCAGCCTCCAC
AATCCCAACGTCCGGGACAGGCCGCCTTTCGAGCGCTTTGTGTCCATGAACCGCGGCATC
AACAATGGTAGCGACCTGCCCGAGGACCAGCTGCGGAACCTCTTCGACAGCATCAAGAGT
GAGCCATTCTCCATCCCTGAGGACGACGGCAATGACCTCACTCACACCTTCTTCAATCCA
GACCGGGAGGGTTGGCTGCTCAAGCTAGGGGGCCGCGTGAAGACGTGGAAACGGCGCTGG
TTCATCCTGACCGACAACTGCCTCTACTACTTCGAGTTCACCACTGACAAGGAGCCACGG
GGAATTATACCTCTTGAGAACCTCTCGGTGCAGAAGGTGGATGACCCCAAGAAGCCATTC
TGCCTGGAGCTCTACAACCCTAGCTGCCGAGGCCAGAAAATCAAGGCCTGCAAGACCGAT
GGCGACGGCAGGGTGGTGGAGGGCAAGCACGAATCGTACCGCATCTCAGCCACCAGTGCC
GAGGAACGTGACCAGTGGATCGAGTCCATCCGAGCCAGCATCACCCGTGTCCCCTTCTAC
GACCTGGTCTCTACTCGGAAGAAGAAGATTGCCAGCAAGCAGTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CYTH4
Symbol Nomenclature : CYTH4
SYNONYM : CYT4; DJ63G5.1; PSCD4
Designation : PH, SEC7 and coiled-coil domain-containing protein 4|cytohesin-4|pleckstrin homology, Sec7 and coiled-coil domains 4|pleckstrin homology, Sec7 and coiled/coil domains 4
Full Nomenclature : cytohesin 4
GENEID : 27128
Locus Tag : RP1-63G5.4
GenBank Accession : 563120
HGNC : 9505
MIM : 606514
Vega : OTTHUMG00000150562
Target GenBank: CU013151

 

Reference Sequence Alignment

  

HsCD00350513      ATGGACCTGTGCCACCCAGAGCCCGCGGAGCTGAGCAGCGGGGAGACGGAAGAGTTACAG
NM_013385.3       ATGGACCTGTGCCACCCAGAGCCCGCGGAGCTGAGCAGCGGGGAGACGGAAGAGTTACAG
                  ************************************************************

HsCD00350513      AGGATCAAGTGGCACCGAAAGCAGCTCCTGGAGGACATCCAGAAGCTGAAGGATGAGATT
NM_013385.3       AGGATCAAGTGGCACCGAAAGCAGCTCCTGGAGGACATCCAGAAGCTGAAGGATGAGATT
                  ************************************************************

HsCD00350513      GCAGATGTGTTTGCCCAAATCGACTGCTTCGAGAGTGCGGAGGAGAGCCGGATGGCCCAG
NM_013385.3       GCAGATGTGTTTGCCCAAATCGACTGCTTCGAGAGTGCGGAGGAGAGCCGGATGGCCCAG
                  ************************************************************

HsCD00350513      AAGGAGAAGGAGCTGTGTATTGGGCGCAAGAAGTTCAACATGGACCCCGCCAAGGGTATC
NM_013385.3       AAGGAGAAGGAGCTGTGTATTGGGCGCAAGAAGTTCAACATGGACCCCGCCAAGGGTATC
                  ************************************************************

HsCD00350513      CAGTATTTCATTGAGCACAAGCTGCTGACCCCTGACGTCCAGGACATTGCACGGTTCCTG
NM_013385.3       CAGTATTTCATTGAGCACAAGCTGCTGACCCCTGACGTCCAGGACATTGCACGGTTCCTG
                  ************************************************************

HsCD00350513      TATAAAGGCGAGGGCCTCAACAAGACAGCCATTGGTACCTACCTGGGGGAGAGGGATCCC
NM_013385.3       TATAAAGGCGAGGGCCTCAACAAGACAGCCATTGGTACCTACCTGGGGGAGAGGGATCCC
                  ************************************************************

HsCD00350513      ATCAACCTGCAGGTCCTCCAGGCCTTCGTGGACTGCCACGAGTTCGCCAACCTCAACCTC
NM_013385.3       ATCAACCTGCAGGTCCTCCAGGCCTTCGTGGACTGCCACGAGTTCGCCAACCTCAACCTC
                  ************************************************************

HsCD00350513      GTCCAGGCCCTCAGGCAGTTCCTGTGGAGCTTCCGGCTGCCGGGCGAGGCCCAGAAGATA
NM_013385.3       GTCCAGGCCCTCAGGCAGTTCCTGTGGAGCTTCCGGCTGCCGGGCGAGGCCCAGAAGATA
                  ************************************************************

HsCD00350513      GACCGGATGATGGAGGCCTTTGCCACTCGATACTGCCTCTGCAACCCAGGCGTCTTCCAG
NM_013385.3       GACCGGATGATGGAGGCCTTTGCCACTCGATACTGCCTCTGCAACCCAGGCGTCTTCCAG
                  ************************************************************

HsCD00350513      TCCACAGACACCTGCTACGTGTTGTCCTTCTCCATCATCATGCTCAACACCAGCCTCCAC
NM_013385.3       TCCACAGACACCTGCTACGTGTTGTCCTTCTCCATCATCATGCTCAACACCAGCCTCCAC
                  ************************************************************

HsCD00350513      AATCCCAACGTCCGGGACAGGCCGCCTTTCGAGCGCTTTGTGTCCATGAACCGCGGCATC
NM_013385.3       AATCCCAACGTCCGGGACAGGCCGCCTTTTGAGCGCTTTGTGTCCATGAACCGCGGCATC
                  ***************************** ******************************

HsCD00350513      AACAATGGTAGCGACCTGCCCGAGGACCAGCTGCGGAACCTCTTCGACAGCATCAAGAGT
NM_013385.3       AACAATGGTAGCGACCTGCCCGAGGACCAGCTGCGGAACCTCTTCGACAGCATCAAGAGT
                  ************************************************************

HsCD00350513      GAGCCATTCTCCATCCCTGAGGACGACGGCAATGACCTCACTCACACCTTCTTCAATCCA
NM_013385.3       GAGCCATTCTCCATCCCTGAGGACGACGGCAATGACCTCACTCACACCTTCTTCAATCCA
                  ************************************************************

HsCD00350513      GACCGGGAGGGTTGGCTGCTCAAGCTAGGGGGCCGCGTGAAGACGTGGAAACGGCGCTGG
NM_013385.3       GACCGGGAGGGTTGGCTGCTCAAGCTAGGGGGCCGCGTGAAGACGTGGAAACGGCGCTGG
                  ************************************************************

HsCD00350513      TTCATCCTGACCGACAACTGCCTCTACTACTTCGAGTTCACCACTGACAAGGAGCCACGG
NM_013385.3       TTCATCCTGACCGACAACTGCCTCTACTACTTCGAGTTCACCACTGACAAGGAGCCACGG
                  ************************************************************

HsCD00350513      GGAATTATACCTCTTGAGAACCTCTCGGTGCAGAAGGTGGATGACCCCAAGAAGCCATTC
NM_013385.3       GGAATTATACCTCTTGAGAACCTCTCGGTGCAGAAGGTGGATGACCCCAAGAAGCCATTC
                  ************************************************************

HsCD00350513      TGCCTGGAGCTCTACAACCCTAGCTGCCGAGGCCAGAAAATCAAGGCCTGCAAGACCGAT
NM_013385.3       TGCCTGGAGCTCTACAACCCTAGCTGCCGAGGCCAGAAAATCAAGGCCTGCAAGACCGAT
                  ************************************************************

HsCD00350513      GGCGACGGCAGGGTGGTGGAGGGCAAGCACGAATCGTACCGCATCTCAGCCACCAGTGCC
NM_013385.3       GGCGACGGCAGGGTGGTGGAGGGCAAGCACGAATCGTACCGCATCTCAGCCACCAGTGCC
                  ************************************************************

HsCD00350513      GAGGAACGTGACCAGTGGATCGAGTCCATCCGAGCCAGCATCACCCGTGTCCCCTTCTAC
NM_013385.3       GAGGAACGTGACCAGTGGATCGAGTCCATCCGAGCCAGCATCACCCGTGTCCCCTTCTAC
                  ************************************************************

HsCD00350513      GACCTGGTCTCTACTCGGAAGAAGAAGATTGCCAGCAAGCAGTGA
NM_013385.3       GACCTGGTCTCTACTCGGAAGAAGAAGATTGCCAGCAAGCAGTGA
                  *********************************************

Protein

SMART domain : Sec7 : Sec7 domain
SMART domain : PH : Pleckstrin homology domain.
UniProt : Q9UIA0
HPRD : 07354

Clone

Cloning Information : 563120

Organism


TAX_ID : 9606
Species Specific ID: 27128

Genome

Chromosome : 22
Map Location : 22q12.3-q13.1
Ensembl : ENSG00000100055

Reagents

Labome : cytohesin-4-antibody