DNASU Plasmid Repository • 480.965.5697 | Email

UBE2L3 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  UBE2L3
Gene Name:  ubiquitin-conjugating enzyme E2L 3
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100000555)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00350541

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 465nts         Open reading frame : 1 to 465
Reference Sequence Alignment

ATGGCGGCCAGCAGGAGGCTGATGAAGGAGCTTGAAGAAATCCGCAAATGTGGGATGAAA
AACTTCCGTAACATCCAGGTTGATGAAGCTAATTTATTGACTTGGCAAGGGCTTATTGTT
CCTGACAACCCTCCATATGATAAGGGAGCCTTCAGAATCGAAATCAACTTTCCAGCAGAG
TACCCATTCAAACCACCGAAGATCACATTTAAAACAAAGATCTATCACCCAAACATCGAC
GAAAAGGGGCAGGTCTGTCTGCCAGTAATTAGTGCCGAAAACTGGAAGCCAGCAACCAAA
ACCGACCAAGTAATCCAGTCCCTCATAGCACTGGTGAATGACCCCCAGCCTGAGCACCCG
CTTCGGGCTGACCTAGCTGAAGAATACTCTAAGGACCGTAAAAAATTCTGTAAGAATGCT
GAAGAGTTTACAAAGAAATATGGGGAAAAGCGACCTGTGGACTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : UBE2L3
Symbol Nomenclature : UBE2L3
SYNONYM : E2-F1; L-UBC; UBCH7; UbcM4
Designation : ubiquitin carrier protein L3|ubiquitin-conjugating enzyme E2 L3|ubiquitin-conjugating enzyme E2-F1|ubiquitin-conjugating enzyme UBCH7|ubiquitin-protein ligase L3
Full Nomenclature : ubiquitin-conjugating enzyme E2L 3
GENEID : 7332
GenBank Accession : 563148
HGNC : 12488
MIM : 603721
Vega : OTTHUMG00000150823
Target GenBank: CU013202

 

Reference Sequence Alignment

  

HsCD00350541        ------------------------------------------------------------
NM_003347.3         ------------------------------------------------------------
NM_001256355.1      ATGCAGGTCGCTGCAGGGACCCGAGGCGACACGCGCCTGCAGGAGGTGGCACTCCTGCCG
                                                                                

HsCD00350541        ------------------------------------------------------------
NM_003347.3         ------------------------------------------------------------
NM_001256355.1      CAGCTCTTCGATCTGCTTGTCCTTGGCCAGCGGCGCGCTCGCCTGCTCCGACAGGTCCCG
                                                                                

HsCD00350541        ------------------------------------------------------ATGGCG
NM_003347.3         ------------------------------------------------------ATGGCG
NM_001256355.1      AGCGCGCTGGCGGGCAAAGACTTGGCACAGCTCCAGGCCGGCGCAACTCTCGCCGGGTAT
                                                                          . * . 

HsCD00350541        GCCAGCAGGAGGCTGATGAAGGAGCTTGAAGAAATCCGCAAATGTGGGATGAAAAACTTC
NM_003347.3         GCCAGCAGGAGGCTGATGAAGGAGCTTGAAGAAATCCGCAAATGTGGGATGAAAAACTTC
NM_001256355.1      AGGCGCGCTCACGGCCCGGAGGAGCTTGAAGAAATCCGCAAATGTGGGATGAAAAACTTC
                    .  .**.  ..    . *.*****************************************

HsCD00350541        CGTAACATCCAGGTTGATGAAGCTAATTTATTGACTTGGCAAGGGCTTATTGTTCCTGAC
NM_003347.3         CGTAACATCCAGGTTGATGAAGCTAATTTATTGACTTGGCAAGGGCTTATTGTTCCTGAC
NM_001256355.1      CGTAACATCCAGGTTGATGAAGCTAATTTATTGACTTGGCAAGGGCTTATTGTTCCTGAC
                    ************************************************************

HsCD00350541        AACCCTCCATATGATAAGGGAGCCTTCAGAATCGAAATCAACTTTCCAGCAGAGTACCCA
NM_003347.3         AACCCTCCATATGATAAGGGAGCCTTCAGAATCGAAATCAACTTTCCAGCAGAGTACCCA
NM_001256355.1      AACCCTCCATATGATAAGGGAGCCTTCAGAATCGAAATCAACTTTCCAGCAGAGTACCCA
                    ************************************************************

HsCD00350541        TTCAAACCACCGAAGATCACATTTAAAACAAAGATCTATCACCCAAACATCGACGAAAAG
NM_003347.3         TTCAAACCACCGAAGATCACATTTAAAACAAAGATCTATCACCCAAACATCGACGAAAAG
NM_001256355.1      TTCAAACCACCGAAGATCACATTTAAAACAAAGATCTATCACCCAAACATCGACGAAAAG
                    ************************************************************

HsCD00350541        GGGCAGGTCTGTCTGCCAGTAATTAGTGCCGAAAACTGGAAGCCAGCAACCAAAACCGAC
NM_003347.3         GGGCAGGTCTGTCTGCCAGTAATTAGTGCCGAAAACTGGAAGCCAGCAACCAAAACCGAC
NM_001256355.1      GGGCAGGTCTGTCTGCCAGTAATTAGTGCCGAAAACTGGAAGCCAGCAACCAAAACCGAC
                    ************************************************************

HsCD00350541        CAAGTAATCCAGTCCCTCATAGCACTGGTGAATGACCCCCAGCCTGAGCACCCGCTTCGG
NM_003347.3         CAAGTAATCCAGTCCCTCATAGCACTGGTGAATGACCCCCAGCCTGAGCACCCGCTTCGG
NM_001256355.1      CAAGTAATCCAGTCCCTCATAGCACTGGTGAATGACCCCCAGCCTGAGCACCCGCTTCGG
                    ************************************************************

HsCD00350541        GCTGACCTAGCTGAAGAATACTCTAAGGACCGTAAAAAATTCTGTAAGAATGCTGAAGAG
NM_003347.3         GCTGACCTAGCTGAAGAATACTCTAAGGACCGTAAAAAATTCTGTAAGAATGCTGAAGAG
NM_001256355.1      GCTGACCTAGCTGAAGAATACTCTAAGGACCGTAAAAAATTCTGTAAGAATGCTGAAGAG
                    ************************************************************

HsCD00350541        TTTACAAAGAAATATGGGGAAAAGCGACCTGTGGACTAA
NM_003347.3         TTTACAAAGAAATATGGGGAAAAGCGACCTGTGGACTAA
NM_001256355.1      TTTACAAAGAAATATGGGGAAAAGCGACCTGTGGACTAA
                    ***************************************

Pathways

NCI : Alpha-synuclein signaling
NCI : BARD1 signaling events
Panther : Parkinson disease
Panther : Ubiquitin proteasome pathway
Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Immune System

Clone

Cloning Information : 563148

Organism


TAX_ID : 9606
Species Specific ID: 7332

Genome

Chromosome : 22
Map Location : 22q11.21
Ensembl : ENSG00000185651

Reagents

Labome : UbcH7-antibody