DNASU Plasmid Repository • 480.965.5697 | Email

PDE8B (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PDE8B
Gene Name:  phosphodiesterase 8B
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100061565)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00350633

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2655nts         Open reading frame : 1 to 2655
Reference Sequence Alignment

ATGGGCTGCGCCCCCAGCATCCATGTCTCGCAGAGCGGCGTGATCTACTGCCGGGACTCG
GACGAGTCCAGCTCGCCCCGCCAGACCACCAGCGTGTCGCAGGGCCCGGCGGCACCCCTG
CCCGGCCTCTTCGTCCAGACCGACGCCGCCGACGCCATCCCCCCGAGCCGCGCGTCGGGA
CCCCCCAGCGTAGCCCGCGTCCGCAGGGCCCGCACCGAGCTGGGCAGCGGTAGCAGCGCG
GGTTCCGCAGCCCCCGCCGCGACCACCAGCAGGGGCCGGAGGCGCCACTGCTGCAGCAGC
GCCGAGGCCGAGACTCAGACCTGCTACACCAGCGTGAAGCAGGTGTCTTCTGCGGAGGTG
CGCATCGGGCCCATGAGACTGACGCAGGACCCTATTCAGGTTTTGCTGATCTTTGCAAAG
GAAGATAGTCAGAGCGATGGCTTCTGGTGGGCCTGCGACAGAGCTGGTTATAGATGCAAT
ATTGCTCGGACTCCAGAGTCAGCCCTTGAATGCTTTCTTGATAAGCATCATGAAATTATT
GTAATTGATCATAGACAAACTCAGAACTTCGATGCAGAAGCAGTGTGCAGGTCGATCCGG
GCCACAAATCCCTCCGAGCACACGGTGATCCTCGCAGTGGTTTCGCGAGTATCGGATGAC
CATGAAGAGGCGTCAGTCCTTCCTCTTCTCCACGCAGGCTTCAACAGGAGATTTATGGAG
AATAGCAGCATAATTGCTTGCTATAATGAACTGATTCAAATAGAACATGGGGAAGTTCGC
TCCCAGTTCAAATTACGGGCCTGTAATTCAGTGTTTACAGCATTAGATCACTGTCATGAA
GCCATAGAAATAACAAGCGATGACCACGTGATTCAGTATGTCAACCCAGCCTTCGAAAGG
ATGATGGGCTACCACAAAGGTGAGCTCCTGGGAAAAGAACTCGCTGATCTGCCCAAAAGC
GATAAGAACCGGGCAGACCTTCTCGACACCATCAATACATGCATCAAGAAGGGAAAGGAG
TGGCAGGGGGTTTACTATGCCAGACGGAAATCCGGGGACAGCATCCAACAGCACGTGAAG
ATCACCCCAGTGATTGGCCAAGGAGGGAAAATTAGGCATTTTGTCTCGCTCAAGAAACTG
TGTTGTACCACTGACAATAATAAGCAGATTCACAAGATTCATCGTGATTCAGGAGACAAT
TCTCAGACAGAGCCTCATTCATTCAGATATAAGAACAGGAGGAAAGAGTCCATTGACGTG
AAATCGATATCATCTCGAGGCAGTGATGCACCAAGCCTGCAGAATCGTCGCTATCCGTCC
ATGGCGAGGATCCACTCCATGACCATCGAGGCTCCCATCACAAAGGTTATAAATATAATC
AATGCAGCCCAAGAAAACAGCCCAGTCACAGTAGCGGAAGCCTTGGACAGAGTTCTAGAG
ATTTTACGGACCACAGAACTGTACTCCCCTCAGCTGGGTACCAAAGATGAAGATCCTCAC
ACCAGTGATCTTGTTGGAGGCCTGATGACTGACGGCTTGAGAAGACTGTCAGGAAACGAG
TATGTGTTTACTAAGAATGTGCACCAGAGTCACAGTCACCTTGCAATGCCAATAACCATC
AATGATGTTCCCCCTTGTATCTCTCAATTACTTGATAATGAGGAGAGTTGGGACTTCAAC
ATCTTTGAATTGGAAGCCATTACGCATAAAAGGCCATTGGTTTATCTGGGCTTAAAGGTC
TTCTCTCGGTTTGGAGTATGTGAGTTTTTAAACTGTTCTGAAACCACTCTTCGGGCCTGG
TTCCAAGTGATCGAAGCCAACTACCACTCTTCCAATGCCTACCACAACTCCACCCATGCT
GCCGACGTCCTGCACGCCACCGCTTTCTTTCTTGGAAAGGAAAGAGTAAAGGGAAGCCTC
GATCAGTTGGATGAGGTGGCAGCCCTCATTGCTGCCACAGTCCATGACGTGGATCACCCG
GGAAGGACCAACTCTTTCCTCTGCAATGCAGGCAGTGAGCTTGCTGTGCTCTACAATGAC
ACTGCTGTTCTGGAGAGTCACCACACCGCCCTGGCCTTCCAGCTCACGGTCAAGGACACC
AAATGCAACATTTTCAAGAATATTGACAGGAACCATTATCGAACGCTGCGCCAGGCTATT
ATTGACATGGTTTTGGCAACAGAGATGACAAAACACTTTGAACATGTGAATAAGTTTGTG
AACAGCATCAACAAGCCAATGGCAGCTGAGATTGAAGGCAGCGACTGTGAATGCAACCCT
GCTGGGAAGAACTTCCCTGAAAACCAAATCCTGATCAAACGCATGATGATTAAGTGTGCT
GACGTGGCCAACCCATGCCGCCCCTTGGACCTGTGCATTGAATGGGCTGGGAGGATCTCT
GAGGAGTATTTTGCACAGACTGATGAAGAGAAGAGACAGGGACTACCTGTGGTGATGCCA
GTGTTTGACCGGAATACCTGTAGCATCCCCAAGTCTCAGATCTCTTTCATTGACTACTTC
ATAACAGACATGTTTGATGCTTGGGATGCCTTTGCACATCTGCCAGCCCTGATGCAACAT
TTGGCTGACAACTACAAACACTGGAAGACACTAGATGACCTAAAGTGCAAAAGTTTGAGG
CTTCCATCTGACAGC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PDE8B
Symbol Nomenclature : PDE8B
SYNONYM : ADSD; PPNAD3
Designation : 3',5' cyclic nucleotide phosphodiesterase 8B|cell proliferation-inducing gene 22 protein|high affinity cAMP-specific and IBMX-insensitive 3',5'-cyclic phosphodiesterase 8B|hsPDE8B
Full Nomenclature : phosphodiesterase 8B
GENEID : 8622
Locus Tag : PIG22
GenBank Accession : 563240
HGNC : 8794
MIM : 603390
Vega : OTTHUMG00000102170
Target GenBank: BC156215

 

Reference Sequence Alignment

  

HsCD00350633        ATGGGCTGCGCCCCCAGCATCCATGTCTCGCAGAGCGGCGTGATCTACTGCCGGGACTCG
NM_003719.3         ATGGGCTGCGCCCCCAGCATCCATGTCTCGCAGAGCGGCGTGATCTACTGCCGGGACTCG
NM_001029853.2      ATGGGCTGCGCCCCCAGCATCCATGTCTCGCAGAGCGGCGTGATCTACTGCCGGGACTCG
NM_001029854.2      ATGGGCTGCGCCCCCAGCATCCATGTCTCGCAGAGCGGCGTGATCTACTGCCGGGACTCG
NM_001029852.2      ATGGGCTGCGCCCCCAGCATCCATGTCTCGCAGAGCGGCGTGATCTACTGCCGGGACTCG
                    ************************************************************

HsCD00350633        GACGAGTCCAGCTCGCCCCGCCAGACCACCAGCGTGTCGCAGGGCCCGGCGGCACCCCTG
NM_003719.3         GACGAGTCCAGCTCGCCCCGCCAGACCACCAGCGTGTCGCAGGGCCCGGCGGCACCCCTG
NM_001029853.2      GACGAGTCCAGCTCGCCCCGCCAGACCACCAGCGTGTCGCAGGGCCCGGCGGCACCCCTG
NM_001029854.2      GACGAGTCCAGCTCGCCCCGCCAGACCACCAGCGTGTCGCAGGGCCCGGCGGCACCCCTG
NM_001029852.2      GACGAGTCCAGCTCGCCCCGCCAGACCACCAGCGTGTCGCAGGGCCCGGCGGCACCCCTG
                    ************************************************************

HsCD00350633        CCCGGCCTCTTCGTCCAGACCGACGCCGCCGACGCCATCCCCCCGAGCCGCGCGTCGGGA
NM_003719.3         CCCGGCCTCTTCGTCCAGACCGACGCCGCCGACGCCATCCCCCCGAGCCGCGCGTCGGGA
NM_001029853.2      CCCGGCCTCTTCGTCCAGACCGACGCCGCCGACGCCATCCCCCCGAGCCGCGCGTCGGGA
NM_001029854.2      CCCGGCCTCTTCGTCCAGACCGACGCCGCCGACGCCATCCCCCCGAGCCGCGCGTCGGGA
NM_001029852.2      CCCGGCCTCTTCGTCCAGACCGACGCCGCCGACGCCATCCCCCCGAGCCGCGCGTCGGGA
                    ************************************************************

HsCD00350633        CCCCCCAGCGTAGCCCGCGTCCGCAGGGCCCGCACCGAGCTGGGCAGCGGTAGCAGCGCG
NM_003719.3         CCCCCCAGCGTAGCCCGCGTCCGCAGGGCCCGCACCGAGCTGGGCAGCGGTAGCAGCGCG
NM_001029853.2      CCCCCCAGCGTAGCCCGCGTCCGCAGGGCCCGCACCGAGCTGGGCAGCGGTAGCAGCGCG
NM_001029854.2      CCCCCCAGCGTAGCCCGCGTCCGCAGGGCCCGCACCGAGCTGGGCAGCGGTAGCAGCGCG
NM_001029852.2      CCCCCCAGCGTAGCCCGCGTCCGCAGGGCCCGCACCGAGCTGGGCAGCGGTAGCAGCGCG
                    ************************************************************

HsCD00350633        GGTTCCGCAGCCCCCGCCGCGACCACCAGCAGGGGCCGGAGGCGCCACTGCTGCAGCAGC
NM_003719.3         GGTTCCGCAGCCCCCGCCGCGACCACCAGCAGGGGCCGGAGGCGCCACTGCTGCAGCAGC
NM_001029853.2      GGTTCCGCAGCCCCCGCCGCGACCACCAGCAGGGGCCGGAGGCGCCACTGCTGCAGCAGC
NM_001029854.2      GGTTCCGCAGCCCCCGCCGCGACCACCAGCAGGGGCCGGAGGCGCCACTGCTGCAGCAGC
NM_001029852.2      GGTTCCGCAGCCCCCGCCGCGACCACCAGCAGGGGCCGGAGGCGCCACTGCTGCAGCAGC
                    ************************************************************

HsCD00350633        GCCGAGGCCGAGACTCAGACCTGCTACACCAGCGTGAAGCAGGTGTCTTCTGCGGAGGTG
NM_003719.3         GCCGAGGCCGAGACTCAGACCTGCTACACCAGCGTGAAGCAGGTGTCTTCTGCGGAGGTG
NM_001029853.2      GCCGAGGCCGAGACTCAGACCTGCTACACCAGCGTGAAGGT-------------------
NM_001029854.2      GCCGAGGCCGAGACTCAGACCTGCTACACCAGCGTGAAGCAGGTGTCTTCTGCGGAGGTG
NM_001029852.2      GCCGAGGCCGAGACTCAGACCTGCTACACCAGCGTGAAGCAGGTGTCTTCTGCGGAGGTG
                    *************************************** :                   

HsCD00350633        CGCATCGGGCCCATGAGACTGACGCAGGACCCTATTCAGGTTTTGCTGATCTTTGCAAAG
NM_003719.3         CGCATCGGGCCCATGAGACTGACGCAGGACCCTATTCAGGTTTTGCTGATCTTTGCAAAG
NM_001029853.2      -----------------------------------------TTTGCTGATCTTTGCAAAG
NM_001029854.2      CGCATCGGGCCCATGAGACTGACGCAGGACCCTATTCAGGTTTTGCTGATCTTTGCAAAG
NM_001029852.2      CGCATCGGGCCCATGAGACTGACGCAGGACCCTATTCAGGTTTTGCTGATCTTTGCAAAG
                                                             *******************

HsCD00350633        GAAGATAGTCAGAGCGATGGCTTCTGGTGGGCCTGCGACAGAGCTGGTTATAGATGCAAT
NM_003719.3         GAAGATAGTCAGAGCGATGGCTTCTGGTGGGCCTGCGACAGAGCTGGTTATAGATGCAAT
NM_001029853.2      GAAGATAGTCAGAGCGATGGCTTCTGGTGGGCCTGCGACAGAGCTGGTTATAGATGCAAT
NM_001029854.2      GAAGATAGTCAGAGCGATGGCTTCTGGTGGGCCTGCGACAGAGCTGGTTATAGATGCAAT
NM_001029852.2      GAAGATAGTCAGAGCGATGGCTTCTGGTGGGCCTGCGACAGAGCTGGTTATAGATGCAAT
                    ************************************************************

HsCD00350633        ATTGCTCGGACTCCAGAGTCAGCCCTTGAATGCTTTCTTGATAAGCATCATGAAATTATT
NM_003719.3         ATTGCTCGGACTCCAGAGTCAGCCCTTGAATGCTTTCTTGATAAGCATCATGAAATTATT
NM_001029853.2      ATTGCTCGGACTCCAGAGTCAGCCCTTGAATGCTTTCTTGATAAGCATCATGAAATTATT
NM_001029854.2      ATTGCTCGGACTCCAGAGTCAGCCCTTGAATGCTTTCTTGATAAGCATCATGAAATTATT
NM_001029852.2      ATTGCTCGGACTCCAGAGTCAGCCCTTGAATGCTTTCTTGATAAGCATCATGAAATTATT
                    ************************************************************

HsCD00350633        GTAATTGATCATAGACAAACTCAGAACTTCGATGCAGAAGCAGTGTGCAGGTCGATCCGG
NM_003719.3         GTAATTGATCATAGACAAACTCAGAACTTCGATGCAGAAGCAGTGTGCAGGTCGATCCGG
NM_001029853.2      GTAATTGATCATAGACAAACTCAGAACTTCGATGCAGAAGCAGTGTGCAGGTCGATCCGG
NM_001029854.2      GTAATTGATCATAGACAAACTCAGAACTTCGATGCAGAAGCAGTGTGCAGGTCGATCCGG
NM_001029852.2      GTAATTGATCATAGACAAACTCAGAACTTCGATGCAGAAGCAGTGTGCAGGTCGATCCGG
                    ************************************************************

HsCD00350633        GCCACAAATCCCTCCGAGCACACGGTGATCCTCGCAGTGGTTTCGCGAGTATCGGATGAC
NM_003719.3         GCCACAAATCCCTCCGAGCACACGGTGATCCTCGCAGTGGTTTCGCGAGTATCGGATGAC
NM_001029853.2      GCCACAAATCCCTCCGAGCACACGGTGATCCTCGCAGTGGTTTCGCGAGTATCGGATGAC
NM_001029854.2      GCCACAAATCCCTCCGAGCACACGGTGATCCTCGCAGTGGTTTCGCGAGTATCGGATGAC
NM_001029852.2      GCCACAAATCCCTCCGAGCACACGGTGATCCTCGCAGTGGTTTCGCGAGTATCGGATGAC
                    ************************************************************

HsCD00350633        CATGAAGAGGCGTCAGTCCTTCCTCTTCTCCACGCAGGCTTCAACAGGAGATTTATGGAG
NM_003719.3         CATGAAGAGGCGTCAGTCCTTCCTCTTCTCCACGCAGGCTTCAACAGGAGATTTATGGAG
NM_001029853.2      CATGAAGAGGCGTCAGTCCTTCCTCTTCTCCACGCAGGCTTCAACAGGAGATTTATGGAG
NM_001029854.2      CATGAAGAGGCGTCAGTCCTTCCTCTTCTCCACGCAGGCTTCAACAGGAGATTTATGGAG
NM_001029852.2      CATGAAGAGGCGTCAGTCCTTCCTCTTCTCCACGCAGGCTTCAACAGGAGATTTATGGAG
                    ************************************************************

HsCD00350633        AATAGCAGCATAATTGCTTGCTATAATGAACTGATTCAAATAGAACATGGGGAAGTTCGC
NM_003719.3         AATAGCAGCATAATTGCTTGCTATAATGAACTGATTCAAATAGAACATGGGGAAGTTCGC
NM_001029853.2      AATAGCAGCATAATTGCTTGCTATAATGAACTGATTCAAATAGAACATGGGGAAGTTCGC
NM_001029854.2      AATAGCAGCATAATTGCTTGCTATAATGAACTGATTCAAATAGAACATGGGGAAGTTCGC
NM_001029852.2      AATAGCAGCATAATTGCTTGCTATAATGAACTGATTCAAATAGAACATGGGGAAGTTCGC
                    ************************************************************

HsCD00350633        TCCCAGTTCAAATTACGGGCCTGTAATTCAGTGTTTACAGCATTAGATCACTGTCATGAA
NM_003719.3         TCCCAGTTCAAATTACGGGCCTGTAATTCAGTGTTTACAGCATTAGATCACTGTCATGAA
NM_001029853.2      TCCCAGTTCAAATTACGGGCCTGTAATTCAGTGTTTACAGCATTAGATCACTGTCATGAA
NM_001029854.2      TCCCAGTTCAAATTACGGGCCTGTAATTCAGTGTTTACAGCATTAGATCACTGTCATGAA
NM_001029852.2      TCCCAGTTCAAATTACGGGCCTGTAATTCAGTGTTTACAGCATTAGATCACTGTCATGAA
                    ************************************************************

HsCD00350633        GCCATAGAAATAACAAGCGATGACCACGTGATTCAGTATGTCAACCCAGCCTTCGAAAGG
NM_003719.3         GCCATAGAAATAACAAGCGATGACCACGTGATTCAGTATGTCAACCCAGCCTTCGAAAGG
NM_001029853.2      GCCATAGAAATAACAAGCGATGACCACGTGATTCAGTATGTCAACCCAGCCTTCGAAAGG
NM_001029854.2      GCCATAGAAATAACAAGCGATGACCACGTGATTCAGGAG---------------------
NM_001029852.2      GCCATAGAAATAACAAGCGATGACCACGTGATTCAGTATGTCAACCCAGCCTTCGAAAGG
                    ************************************ *                      

HsCD00350633        ATGATGGGCTACCACAAAGGTGAGCTCCTGGGAAAAGAACTCGCTGATCTGCCCAAAAGC
NM_003719.3         ATGATGGGCTACCACAAAGGTGAGCTCCTGGGAAAAGAACTCGCTGATCTGCCCAAAAGC
NM_001029853.2      ATGATGGGCTACCACAAAGGTGAGCTCCTGGGAAAAGAACTCGCTGATCTGCCCAAAAGC
NM_001029854.2      ------------------------------------------------------------
NM_001029852.2      ATGATGGGCTACCACAAAGGTGAGCTCCTGGGAAAAGAACTCGCTGATCTGCCCAAAAGC
                                                                                

HsCD00350633        GATAAGAACCGGGCAGACCTTCTCGACACCATCAATACATGCATCAAGAAGGGAAAGGAG
NM_003719.3         GATAAGAACCGGGCAGACCTTCTCGACACCATCAATACATGCATCAAGAAGGGAAAGGAG
NM_001029853.2      GATAAGAACCGGGCAGACCTTCTCGACACCATCAATACATGCATCAAGAAGGGAAAGGAG
NM_001029854.2      ------------------------------------------------------------
NM_001029852.2      GATAAGAACCGGGCAGACCTTCTCGACACCATCAATACATGCATCAAGAAGGGAAAGGAG
                                                                                

HsCD00350633        TGGCAGGGGGTTTACTATGCCAGACGGAAATCCGGGGACAGCATCCAACAGCACGTGAAG
NM_003719.3         TGGCAGGGGGTTTACTATGCCAGACGGAAATCCGGGGACAGCATCCAACAGCACGTGAAG
NM_001029853.2      TGGCAGGGGGTTTACTATGCCAGACGGAAATCCGGGGACAGCATCCAACAGCACGTGAAG
NM_001029854.2      TGGCAGGGGGTTTACTATGCCAGACGGAAATCCGGGGACAGCATCCAACAGCACGTGAAG
NM_001029852.2      TGGCAGGGGGTTTACTATGCCAGACGGAAATCCGGGGACAGCATCCAACAGCACGTGAAG
                    ************************************************************

HsCD00350633        ATCACCCCAGTGATTGGCCAAGGAGGGAAAATTAGGCATTTTGTCTCGCTCAAGAAACTG
NM_003719.3         ATCACCCCAGTGATTGGCCAAGGAGGGAAAATTAGGCATTTTGTCTCGCTCAAGAAACTG
NM_001029853.2      ATCACCCCAGTGATTGGCCAAGGAGGGAAAATTAGGCATTTTGTCTCGCTCAAGAAACTG
NM_001029854.2      ATCACCCCAGTGATTGGCCAAGGAGGGAAAATTAGGCATTTTGTCTCGCTCAAGAAACTG
NM_001029852.2      ATCACCCCAGTGATTGGCCAAGGAGGGAAAATTAGGCATTTTGTCTCGCTCAAGAAACTG
                    ************************************************************

HsCD00350633        TGTTGTACCACTGACAATAATAAGCAGATTCACAAGATTCATCGTGATTCAGGAGACAAT
NM_003719.3         TGTTGTACCACTGACAATAATAAGCAGATTCACAAGATTCATCGTGATTCAGGAGACAAT
NM_001029853.2      TGTTGTACCACTGACAATAATAAGCAGATTCACAAGATTCATCGTGATTCAGGAGACAAT
NM_001029854.2      TGTTGTACCACTGACAATAATAAGCAGATTCACAAGATTCATCGTGATTCAGGAGACAAT
NM_001029852.2      TGTTGTACCACTGACAATAATAAGCAGATTCACAAGATTCATCGTGATTCAGGAGACAAT
                    ************************************************************

HsCD00350633        TCTCAGACAGAGCCTCATTCATTCAGATATAAGAACAGGAGGAAAGAGTCCATTGACGTG
NM_003719.3         TCTCAGACAGAGCCTCATTCATTCAGATATAAGAACAGGAGGAAAGAGTCCATTGACGTG
NM_001029853.2      TCTCAGACAGAGCCTCATTCATTCAGATATAAGAACAGGAGGAAAGAGTCCATTGACGTG
NM_001029854.2      TCTCAGACAGAGCCTCATTCATTCAGATATAAGAACAGGAGGAAAGAGTCCATTGACGTG
NM_001029852.2      TCTCAGACAGAGCCTCATTCATTCAGATATAAGAACAGGAGGAAAGAGTCCATTGACGTG
                    ************************************************************

HsCD00350633        AAATCGATATCATCTCGAGGCAGTGATGCACCAAGCCTGCAGAATCGTCGCTATCCGTCC
NM_003719.3         AAATCGATATCATCTCGAGGCAGTGATGCACCAAGCCTGCAGAATCGTCGCTATCCGTCC
NM_001029853.2      AAATCGATATCATCTCGAGGCAGTGATGCACCAAGCCTGCAGAATCGTCGCTATCCGTCC
NM_001029854.2      AAATCGATATCATCTCGAGGCAGTGATGCACCAAGCCTGCAGAATCGTCGCTATCCGTCC
NM_001029852.2      AAATCGATATCATCTCGAGGCAGTGATGCACCAAGCCTGCAGAATCGTCGCTATCCGTCC
                    ************************************************************

HsCD00350633        ATGGCGAGGATCCACTCCATGACCATCGAGGCTCCCATCACAAAGGTTATAAATATAATC
NM_003719.3         ATGGCGAGGATCCACTCCATGACCATCGAGGCTCCCATCACAAAGGTTATAAATATAATC
NM_001029853.2      ATGGCGAGGATCCACTCCATGACCATCGAGGCTCCCATCACAAAGGTTATAAATATAATC
NM_001029854.2      ATGGCGAGGATCCACTCCATGACCATCGAGGCTCCCATCACAAAGGTTATAAATATAATC
NM_001029852.2      ATGGCGAGGATCCACTCCATGACCATCGAGGCTCCCATCACAAAG---------------
                    *********************************************               

HsCD00350633        AATGCAGCCCAAGAAAACAGCCCAGTCACAGTAGCGGAAGCCTTGGACAGAGTTCTAGAG
NM_003719.3         AATGCAGCCCAAGAAAACAGCCCAGTCACAGTAGCGGAAGCCTTGGACAGAGTTCTAGAG
NM_001029853.2      AATGCAGCCCAAGAAAACAGCCCAGTCACAGTAGCGGAAGCCTTGGACAGAGTTCTAGAG
NM_001029854.2      AATGCAGCCCAAGAAAACAGCCCAGTCACAGTAGCGGAAGCCTTGGACAGAGTTCTAGAG
NM_001029852.2      ------------------------------------------------------------
                                                                                

HsCD00350633        ATTTTACGGACCACAGAACTGTACTCCCCTCAGCTGGGTACCAAAGATGAAGATCCTCAC
NM_003719.3         ATTTTACGGACCACAGAACTGTACTCCCCTCAGCTGGGTACCAAAGATGAAGATCCCCAC
NM_001029853.2      ATTTTACGGACCACAGAACTGTACTCCCCTCAGCTGGGTACCAAAGATGAAGATCCCCAC
NM_001029854.2      ATTTTACGGACCACAGAACTGTACTCCCCTCAGCTGGGTACCAAAGATGAAGATCCCCAC
NM_001029852.2      ------------------------------------------------------------
                                                                                

HsCD00350633        ACCAGTGATCTTGTTGGAGGCCTGATGACTGACGGCTTGAGAAGACTGTCAGGAAACGAG
NM_003719.3         ACCAGTGATCTTGTTGGAGGCCTGATGACTGACGGCTTGAGAAGACTGTCAGGAAACGAG
NM_001029853.2      ACCAGTGATCTTGTTGGAGGCCTGATGACTGACGGCTTGAGAAGACTGTCAGGAAACGAG
NM_001029854.2      ACCAGTGATCTTGTTGGAGGCCTGATGACTGACGGCTTGAGAAGACTGTCAGGAAACGAG
NM_001029852.2      ------------------------------GACGGCTTGAGAAGACTGTCAGGAAACGAG
                                                  ******************************

HsCD00350633        TATGTGTTTACTAAGAATGTGCACCAGAGTCACAGTCACCTTGCAATGCCAATAACCATC
NM_003719.3         TATGTGTTTACTAAGAATGTGCACCAGAGTCACAGTCACCTTGCAATGCCAATAACCATC
NM_001029853.2      TATGTGTTTACTAAGAATGTGCACCAGAGTCACAGTCACCTTGCAATGCCAATAACCATC
NM_001029854.2      TATGTGTTTACTAAGAATGTGCACCAGAGTCACAGTCACCTTGCAATGCCAATAACCATC
NM_001029852.2      TATGTGTTTACTAAGAATGTGCACCAGAGTCACAGTCACCTTGCAATGCCAATAACCATC
                    ************************************************************

HsCD00350633        AATGATGTTCCCCCTTGTATCTCTCAATTACTTGATAATGAGGAGAGTTGGGACTTCAAC
NM_003719.3         AATGATGTTCCCCCTTGTATCTCTCAATTACTTGATAATGAGGAGAGTTGGGACTTCAAC
NM_001029853.2      AATGATGTTCCCCCTTGTATCTCTCAATTACTTGATAATGAGGAGAGTTGGGACTTCAAC
NM_001029854.2      AATGATGTTCCCCCTTGTATCTCTCAATTACTTGATAATGAGGAGAGTTGGGACTTCAAC
NM_001029852.2      AATGATGTTCCCCCTTGTATCTCTCAATTACTTGATAATGAGGAGAGTTGGGACTTCAAC
                    ************************************************************

HsCD00350633        ATCTTTGAATTGGAAGCCATTACGCATAAAAGGCCATTGGTTTATCTGGGCTTAAAGGTC
NM_003719.3         ATCTTTGAATTGGAAGCCATTACGCATAAAAGGCCATTGGTTTATCTGGGCTTAAAGGTC
NM_001029853.2      ATCTTTGAATTGGAAGCCATTACGCATAAAAGGCCATTGGTTTATCTGGGCTTAAAGGTC
NM_001029854.2      ATCTTTGAATTGGAAGCCATTACGCATAAAAGGCCATTGGTTTATCTGGGCTTAAAGGTC
NM_001029852.2      ATCTTTGAATTGGAAGCCATTACGCATAAAAGGCCATTGGTTTATCTGGGCTTAAAGGTC
                    ************************************************************

HsCD00350633        TTCTCTCGGTTTGGAGTATGTGAGTTTTTAAACTGTTCTGAAACCACTCTTCGGGCCTGG
NM_003719.3         TTCTCTCGGTTTGGAGTATGTGAATTTTTAAACTGTTCTGAAACCACTCTTCGGGCCTGG
NM_001029853.2      TTCTCTCGGTTTGGAGTATGTGAATTTTTAAACTGTTCTGAAACCACTCTTCGGGCCTGG
NM_001029854.2      TTCTCTCGGTTTGGAGTATGTGAATTTTTAAACTGTTCTGAAACCACTCTTCGGGCCTGG
NM_001029852.2      TTCTCTCGGTTTGGAGTATGTGAATTTTTAAACTGTTCTGAAACCACTCTTCGGGCCTGG
                    ***********************.************************************

HsCD00350633        TTCCAAGTGATCGAAGCCAACTACCACTCTTCCAATGCCTACCACAACTCCACCCATGCT
NM_003719.3         TTCCAAGTGATCGAAGCCAACTACCACTCTTCCAATGCCTACCACAACTCCACCCATGCT
NM_001029853.2      TTCCAAGTGATCGAAGCCAACTACCACTCTTCCAATGCCTACCACAACTCCACCCATGCT
NM_001029854.2      TTCCAAGTGATCGAAGCCAACTACCACTCTTCCAATGCCTACCACAACTCCACCCATGCT
NM_001029852.2      TTCCAAGTGATCGAAGCCAACTACCACTCTTCCAATGCCTACCACAACTCCACCCATGCT
                    ************************************************************

HsCD00350633        GCCGACGTCCTGCACGCCACCGCTTTCTTTCTTGGAAAGGAAAGAGTAAAGGGAAGCCTC
NM_003719.3         GCCGACGTCCTGCACGCCACCGCTTTCTTTCTTGGAAAGGAAAGAGTAAAGGGAAGCCTC
NM_001029853.2      GCCGACGTCCTGCACGCCACCGCTTTCTTTCTTGGAAAGGAAAGAGTAAAGGGAAGCCTC
NM_001029854.2      GCCGACGTCCTGCACGCCACCGCTTTCTTTCTTGGAAAGGAAAGAGTAAAGGGAAGCCTC
NM_001029852.2      GCCGACGTCCTGCACGCCACCGCTTTCTTTCTTGGAAAGGAAAGAGTAAAGGGAAGCCTC
                    ************************************************************

HsCD00350633        GATCAGTTGGATGAGGTGGCAGCCCTCATTGCTGCCACAGTCCATGACGTGGATCACCCG
NM_003719.3         GATCAGTTGGATGAGGTGGCAGCCCTCATTGCTGCCACAGTCCATGACGTGGATCACCCG
NM_001029853.2      GATCAGTTGGATGAGGTGGCAGCCCTCATTGCTGCCACAGTCCATGACGTGGATCACCCG
NM_001029854.2      GATCAGTTGGATGAGGTGGCAGCCCTCATTGCTGCCACAGTCCATGACGTGGATCACCCG
NM_001029852.2      GATCAGTTGGATGAGGTGGCAGCCCTCATTGCTGCCACAGTCCATGACGTGGATCACCCG
                    ************************************************************

HsCD00350633        GGAAGGACCAACTCTTTCCTCTGCAATGCAGGCAGTGAGCTTGCTGTGCTCTACAATGAC
NM_003719.3         GGAAGGACCAACTCTTTCCTCTGCAATGCAGGCAGTGAGCTTGCTGTGCTCTACAATGAC
NM_001029853.2      GGAAGGACCAACTCTTTCCTCTGCAATGCAGGCAGTGAGCTTGCTGTGCTCTACAATGAC
NM_001029854.2      GGAAGGACCAACTCTTTCCTCTGCAATGCAGGCAGTGAGCTTGCTGTGCTCTACAATGAC
NM_001029852.2      GGAAGGACCAACTCTTTCCTCTGCAATGCAGGCAGTGAGCTTGCTGTGCTCTACAATGAC
                    ************************************************************

HsCD00350633        ACTGCTGTTCTGGAGAGTCACCACACCGCCCTGGCCTTCCAGCTCACGGTCAAGGACACC
NM_003719.3         ACTGCTGTTCTGGAGAGTCACCACACCGCCCTGGCCTTCCAGCTCACGGTCAAGGACACC
NM_001029853.2      ACTGCTGTTCTGGAGAGTCACCACACCGCCCTGGCCTTCCAGCTCACGGTCAAGGACACC
NM_001029854.2      ACTGCTGTTCTGGAGAGTCACCACACCGCCCTGGCCTTCCAGCTCACGGTCAAGGACACC
NM_001029852.2      ACTGCTGTTCTGGAGAGTCACCACACCGCCCTGGCCTTCCAGCTCACGGTCAAGGACACC
                    ************************************************************

HsCD00350633        AAATGCAACATTTTCAAGAATATTGACAGGAACCATTATCGAACGCTGCGCCAGGCTATT
NM_003719.3         AAATGCAACATTTTCAAGAATATTGACAGGAACCATTATCGAACGCTGCGCCAGGCTATT
NM_001029853.2      AAATGCAACATTTTCAAGAATATTGACAGGAACCATTATCGAACGCTGCGCCAGGCTATT
NM_001029854.2      AAATGCAACATTTTCAAGAATATTGACAGGAACCATTATCGAACGCTGCGCCAGGCTATT
NM_001029852.2      AAATGCAACATTTTCAAGAATATTGACAGGAACCATTATCGAACGCTGCGCCAGGCTATT
                    ************************************************************

HsCD00350633        ATTGACATGGTTTTGGCAACAGAGATGACAAAACACTTTGAACATGTGAATAAGTTTGTG
NM_003719.3         ATTGACATGGTTTTGGCAACAGAGATGACAAAACACTTTGAACATGTGAATAAGTTTGTG
NM_001029853.2      ATTGACATGGTTTTGGCAACAGAGATGACAAAACACTTTGAACATGTGAATAAGTTTGTG
NM_001029854.2      ATTGACATGGTTTTGGCAACAGAGATGACAAAACACTTTGAACATGTGAATAAGTTTGTG
NM_001029852.2      ATTGACATGGTTTTGGCAACAGAGATGACAAAACACTTTGAACATGTGAATAAGTTTGTG
                    ************************************************************

HsCD00350633        AACAGCATCAACAAGCCAATGGCAGCTGAGATTGAAGGCAGCGACTGTGAATGCAACCCT
NM_003719.3         AACAGCATCAACAAGCCAATGGCAGCTGAGATTGAAGGCAGCGACTGTGAATGCAACCCT
NM_001029853.2      AACAGCATCAACAAGCCAATGGCAGCTGAGATTGAAGGCAGCGACTGTGAATGCAACCCT
NM_001029854.2      AACAGCATCAACAAGCCAATGGCAGCTGAGATTGAAGGCAGCGACTGTGAATGCAACCCT
NM_001029852.2      AACAGCATCAACAAGCCAATGGCAGCTGAGATTGAAGGCAGCGACTGTGAATGCAACCCT
                    ************************************************************

HsCD00350633        GCTGGGAAGAACTTCCCTGAAAACCAAATCCTGATCAAACGCATGATGATTAAGTGTGCT
NM_003719.3         GCTGGGAAGAACTTCCCTGAAAACCAAATCCTGATCAAACGCATGATGATTAAGTGTGCT
NM_001029853.2      GCTGGGAAGAACTTCCCTGAAAACCAAATCCTGATCAAACGCATGATGATTAAGTGTGCT
NM_001029854.2      GCTGGGAAGAACTTCCCTGAAAACCAAATCCTGATCAAACGCATGATGATTAAGTGTGCT
NM_001029852.2      GCTGGGAAGAACTTCCCTGAAAACCAAATCCTGATCAAACGCATGATGATTAAGTGTGCT
                    ************************************************************

HsCD00350633        GACGTGGCCAACCCATGCCGCCCCTTGGACCTGTGCATTGAATGGGCTGGGAGGATCTCT
NM_003719.3         GACGTGGCCAACCCATGCCGCCCCTTGGACCTGTGCATTGAATGGGCTGGGAGGATCTCT
NM_001029853.2      GACGTGGCCAACCCATGCCGCCCCTTGGACCTGTGCATTGAATGGGCTGGGAGGATCTCT
NM_001029854.2      GACGTGGCCAACCCATGCCGCCCCTTGGACCTGTGCATTGAATGGGCTGGGAGGATCTCT
NM_001029852.2      GACGTGGCCAACCCATGCCGCCCCTTGGACCTGTGCATTGAATGGGCTGGGAGGATCTCT
                    ************************************************************

HsCD00350633        GAGGAGTATTTTGCACAGACTGATGAAGAGAAGAGACAGGGACTACCTGTGGTGATGCCA
NM_003719.3         GAGGAGTATTTTGCACAGACTGATGAAGAGAAGAGACAGGGACTACCTGTGGTGATGCCA
NM_001029853.2      GAGGAGTATTTTGCACAGACTGATGAAGAGAAGAGACAGGGACTACCTGTGGTGATGCCA
NM_001029854.2      GAGGAGTATTTTGCACAGACTGATGAAGAGAAGAGACAGGGACTACCTGTGGTGATGCCA
NM_001029852.2      GAGGAGTATTTTGCACAGACTGATGAAGAGAAGAGACAGGGACTACCTGTGGTGATGCCA
                    ************************************************************

HsCD00350633        GTGTTTGACCGGAATACCTGTAGCATCCCCAAGTCTCAGATCTCTTTCATTGACTACTTC
NM_003719.3         GTGTTTGACCGGAATACCTGTAGCATCCCCAAGTCTCAGATCTCTTTCATTGACTACTTC
NM_001029853.2      GTGTTTGACCGGAATACCTGTAGCATCCCCAAGTCTCAGATCTCTTTCATTGACTACTTC
NM_001029854.2      GTGTTTGACCGGAATACCTGTAGCATCCCCAAGTCTCAGATCTCTTTCATTGACTACTTC
NM_001029852.2      GTGTTTGACCGGAATACCTGTAGCATCCCCAAGTCTCAGATCTCTTTCATTGACTACTTC
                    ************************************************************

HsCD00350633        ATAACAGACATGTTTGATGCTTGGGATGCCTTTGCACATCTGCCAGCCCTGATGCAACAT
NM_003719.3         ATAACAGACATGTTTGATGCTTGGGATGCCTTTGCACATCTGCCAGCCCTGATGCAACAT
NM_001029853.2      ATAACAGACATGTTTGATGCTTGGGATGCCTTTGCACATCTGCCAGCCCTGATGCAACAT
NM_001029854.2      ATAACAGACATGTTTGATGCTTGGGATGCCTTTGCACATCTGCCAGCCCTGATGCAACAT
NM_001029852.2      ATAACAGACATGTTTGATGCTTGGGATGCCTTTGCACATCTGCCAGCCCTGATGCAACAT
                    ************************************************************

HsCD00350633        TTGGCTGACAACTACAAACACTGGAAGACACTAGATGACCTAAAGTGCAAAAGTTTGAGG
NM_003719.3         TTGGCTGACAACTACAAACACTGGAAGACACTAGATGACCTAAAGTGCAAAAGTTTGAGG
NM_001029853.2      TTGGCTGACAACTACAAACACTGGAAGACACTAGATGACCTAAAGTGCAAAAGTTTGAGG
NM_001029854.2      TTGGCTGACAACTACAAACACTGGAAGACACTAGATGACCTAAAGTGCAAAAGTTTGAGG
NM_001029852.2      TTGGCTGACAACTACAAACACTGGAAGACACTAGATGACCTAAAGTGCAAAAGTTTGAGG
                    ************************************************************

HsCD00350633        CTTCCATCTGACAGC---
NM_003719.3         CTTCCATCTGACAGCTAA
NM_001029853.2      CTTCCATCTGACAGCTAA
NM_001029854.2      CTTCCATCTGACAGCTAA
NM_001029852.2      CTTCCATCTGACAGCTAA
                    ***************   

Pathways

Reactome : G alpha (s) signalling events
Reactome : GPCR downstream signaling
Reactome : Signal Transduction
Reactome : Signaling by GPCR
WikiPathway : G Protein Signaling Pathways

Protein

SMART domain : PAS : PAS domain
SMART domain : HDc : Metal dependent phosphohydrolases with conserved "HD" motif.
UniProt : O95263
UniProt : B3KN77
HPRD : 04546

Clone

Cloning Information : 563240

Organism


TAX_ID : 9606
Species Specific ID: 8622

Genome

Chromosome : 5
Map Location : 5q13.3
Ensembl : ENSG00000113231

Reagents

Labome : PDE8B-antibody