DNASU Plasmid Repository • 480.965.5697 | Email

RAC1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RAC1
Gene Name:  ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH023877.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00003507

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 579nts         Open reading frame : 1 to 579
Reference Sequence Alignment

ATGCAGGCCATCAAGTGTGTGGTGGTGGGAGACGGAGCTGTAGGTAAAACTTGCCTACTG
ATCAGTTACACAACCAATGCATTTCCTGGAGAATATATCCCTACTGTCTTTGACAATTAT
TCTGCCAATGTTATGGTAGATGGAAAACCGGTGAATCTGGGCTTATGGGATACAGCTGGA
CAAGAAGATTATGACAGATTACGCCCCCTATCCTATCCGCAAACAGATGTGTTCTTAATT
TGCTTTTCCCTTGTGAGTCCTGCATCATTTGAAAATGTCCGTGCAAAGTGGTATCCTGAG
GTGCGGCACCACTGTCCCAACACTCCCATCATCCTAGTGGGAACTAAACTTGATCTTAGG
GATGATAAAGACACGATCGAGAAACTGAAGGAGAAGAAGCTGATTCCCATCACCTATCCG
CAGGGTCTAGCCATGGCTAAGGAGATTGGTGCTGTAAAATACCTGGAGTGCTCGGCGCTC
ACACAGCGAGGCCTCAAGACAGTGTTTGACGAAGCGATCCGAGCAGTCCTCTGCCCGCCT
CCCGTGAAGAAGAGGAAGAGAAAATGCCTGCTGTTGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 717
Start on reference sequence 139
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RAC1
Symbol Nomenclature : RAC1
SYNONYM : Rac-1; TC-25; p21-Rac1
Designation : cell migration-inducing gene 5 protein|ras-like protein TC25|ras-related C3 botulinum toxin substrate 1
Full Nomenclature : ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
GENEID : 5879
Locus Tag : MIG5
GI : 60655842
GenBank Accession : AY889694
HGNC : 9801
MIM : 602048
Vega : OTTHUMG00000023540
Target GenBank: BC004247

 

Reference Sequence Alignment

  

HsCD00003507      ATGCAGGCCATCAAGTGTGTGGTGGTGGGAGACGGAGCTGTAGGTAAAACTTGCCTACTG
NM_005052.2       ATGCAGGCCATCAAGTGCGTGGTGGTCGGCGACGGCGCCGTGGGGAAGACATGCTTGCTG
NM_006908.4       ATGCAGGCCATCAAGTGTGTGGTGGTGGGAGACGGAGCTGTAGGTAAAACTTGCCTACTG
NM_002872.4       ATGCAGGCCATCAAGTGTGTGGTGGTGGGAGATGGGGCCGTGGGCAAGACCTGCCTTCTC
                  ***************** ******** **.** ** ** **.** **.** *** * ** 

HsCD00003507      ATCAGTTACACAACCAATGCATTTCCTGGAGAATATATCCCTACTGTCTTTGACAATTAT
NM_005052.2       ATCAGCTACACGACCAACGCCTTCCCCGGAGAGTACATCCCCACCGTTTTTGACAACTAC
NM_006908.4       ATCAGTTACACAACCAATGCATTTCCTGGAGAATATATCCCTACTGTCTTTGACAATTAT
NM_002872.4       ATCAGCTACACCACCAACGCCTTTCCCGGAGAGTACATCCCCACCGTGTTTGACAACTAT
                  ***** ***** ***** **.** ** *****.** ***** ** ** ******** ** 

HsCD00003507      TCTGCCAATGTTATGGTAGATGGAAAACCGGTGAATCTGGGCTTATGGGATACAGCTGGA
NM_005052.2       TCTGCCAACGTGATGGTGGACGGGAAACCAGTCAACTTGGGGCTGTGGGACACAGCGGGT
NM_006908.4       TCTGCCAATGTTATGGTAGATGGAAAACCGGTGAATCTGGGCTTATGGGATACAGCTGGA
NM_002872.4       TCAGCCAATGTGATGGTGGACAGCAAGCCAGTGAACCTGGGGCTGTGGGACACTGCTGGG
                  **:***** ** *****.** .* **.**.** **  ****  *.***** **:** ** 

HsCD00003507      CAAGAAGATTATGACAGATTACGCCCCCTATCCTATCCGCAAACAGATGTGTTCTTAATT
NM_005052.2       CAGGAGGACTACGATCGGCTGCGGCCACTCTCCTACCCCCAAACTGACGTCTTTCTGATC
NM_006908.4       CAAGAAGATTATGACAGATTACGCCCCCTATCCTATCCGCAAACAGATGTGTTCTTAATT
NM_002872.4       CAGGAGGACTACGACCGTCTCCGGCCGCTCTCCTATCCACAGACGGACGTCTTCCTCATC
                  **.**.** ** ** .*  * ** ** **.***** ** **.** ** ** **  * ** 

HsCD00003507      TGCTTTTCCCTTGTGAGTCCTGCATCATTTGAAAATGTCCGTGCAAAGTGGTATCCTGAG
NM_005052.2       TGCTTCTCTCTGGTGAGCCCGGCCTCCTTCGAGAATGTTCGTGCCAAGTGGTACCCGGAG
NM_006908.4       TGCTTTTCCCTTGTGAGTCCTGCATCATTTGAAAATGTCCGTGCAAAGTGGTATCCTGAG
NM_002872.4       TGCTTCTCCCTCGTCAGCCCAGCCTCTTATGAGAACGTCCGCGCCAAGTGGTTCCCAGAA
                  ***** ** ** ** ** ** **.** *: **.** ** ** **.*******: ** **.

HsCD00003507      GTGCGGCACCACTGTCCCAACACTCCCATCATCCTAGTGGGAACTAAACTTGATCTTAGG
NM_005052.2       GTGCGGCACCACTGCCCCCACACGCCCATCCTCCTGGTGGGCACCAAGCTGGACCTCCGC
NM_006908.4       GTGCGGCACCACTGTCCCAACACTCCCATCATCCTAGTGGGAACTAAACTTGATCTTAGG
NM_002872.4       GTGCGGCACCACTGCCCCAGCACACCCATCATCCTGGTGGGCACCAAGCTGGACCTGCGG
                  ************** ***..*** ******.****.*****.** **.** ** ** .* 

HsCD00003507      GATGATAAAGACACGATCGAGAAACTGAAGGAGAAGAAGCTGATTCCCATCACCTATCCG
NM_005052.2       GACGACAAGGACACCATTGAGCGGCTGCGGGACAAGAAGCTGGCACCCATCACCTACCCA
NM_006908.4       GATGATAAAGACACGATCGAGAAACTGAAGGAGAAGAAGCTGACTCCCATCACCTATCCG
NM_002872.4       GACGACAAGGACACCATCGAGAAACTGAAGGAGAAGAAGCTGGCTCCCATCACCTACCCG
                  ** ** **.***** ** ***...***..*** *********. :*********** **.

HsCD00003507      CAGGGTCTAGCCATGGCTAAGGAGATTGGTGCTGTAAAATACCTGGAGTGCTCGGCGCTC
NM_005052.2       CAGGGCCTGGCCATGGCCCGGGAGATTGGCTCTGTGAAATACCTGGAGTGCTCAGCCCTG
NM_006908.4       CAGGGTCTAGCCATGGCTAAGGAGATTGGTGCTGTAAAATACCTGGAGTGCTCGGCGCTC
NM_002872.4       CAGGGCCTGGCACTGGCCAAGGAGATTGACTCGGTGAAATACCTGGAGTGCTCAGCTCTC
                  ***** **.**..**** ..********.  * **.*****************.** ** 

HsCD00003507      ACACAGCGAGGCCTCAAGACAGTGTTTGACGAAGCGATCCGAGCAGTCCTCTGCCCGCCT
NM_005052.2       ACCCAGCGGGGCCTGAAGACAGTGTTTGACGAGGCGATCCGCGCGGTGCTCTGCCCGCCC
NM_006908.4       ACACAGCGAGGCCTCAAGACAGTGTTTGACGAAGCGATCCGAGCAGTCCTCTGCCCGCCT
NM_002872.4       ACCCAGAGAGGCCTGAAAACCGTGTTCGACGAGGCCATCCGGGCCGTGCTGTGCCCTCAG
                  **.***.*.***** **.**.***** *****.** ***** ** ** ** ***** *. 

HsCD00003507      CCCGTGAAGAAGAGGAAGAGAAAATGCCTGCTGTTGTAG
NM_005052.2       CCAGTGAAGAAGCCGGGGAAGAAGTGCACCGTCTTCTAG
NM_006908.4       CCCGTGAAGAAGAGGAAGAGAAAATGCCTGCTGTTGTAA
NM_002872.4       CCCACGCGGCAGCAGAAGCGCGCCTGCAGCCTCCTCTAG
                  **.. *..*.**. *..*.. .. ***.   *  * **.

Pathways

NCI : Alpha4 beta1 integrin signaling events
NCI : Alpha9 beta1 integrin signaling events
NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Arf1 pathway
NCI : Arf6 downstream pathway
NCI : BCR signaling pathway
NCI : CDC42 signaling events
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : E-cadherin signaling in keratinocytes
NCI : E-cadherin signaling in the nascent adherens junction
NCI : EPHA2 forward signaling
NCI : EPHB forward signaling
NCI : Endothelins
NCI : Ephrin B reverse signaling
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : IL2 signaling events mediated by PI3K
NCI : IL6-mediated signaling events
NCI : Integrin-linked kinase signaling
NCI : Integrins in angiogenesis
NCI : LPA receptor mediated events
NCI : Lissencephaly gene (LIS1) in neuronal migration and development
NCI : N-cadherin signaling events
NCI : Nectin adhesion pathway
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Netrin-mediated signaling events
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Noncanonical Wnt signaling pathway
NCI : Nongenotropic Androgen signaling
NCI : Osteopontin-mediated events
NCI : PDGFR-beta signaling pathway
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : RAC1 signaling pathway
NCI : Regulation of RAC1 activity
NCI : Regulation of p38-alpha and p38-beta
NCI : S1P1 pathway
NCI : S1P2 pathway
NCI : S1P3 pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PRL
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : Syndecan-4-mediated signaling events
NCI : Thromboxane A2 receptor signaling
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : mTOR signaling pathway
NCI : p38 MAPK signaling pathway
NCI : p75(NTR)-mediated signaling
Panther : Axon guidance mediated by Slit/Robo
Panther : Axon guidance mediated by netrin
Panther : Axon guidance mediated by semaphorins
Panther : B cell activation
Panther : Cytoskeletal regulation by Rho GTPase
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Huntington disease
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Integrin signalling pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Reactome : Activation of Rac
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : CD28 co-stimulation
Reactome : CD28 dependent Vav1 pathway
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Cell-Cell communication
Reactome : Costimulation by the CD28 family
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : DCC mediated attractive signaling
Reactome : DSCAM interactions
Reactome : Developmental Biology
Reactome : Disease
Reactome : FCERI mediated MAPK activation
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : G alpha (12/13) signalling events
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : HIV Infection
Reactome : Hemostasis
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : Inactivation of Cdc42 and Rac
Reactome : Innate Immune System
Reactome : L1CAM interactions
Reactome : Membrane Trafficking
Reactome : NRAGE signals death through JNK
Reactome : Nef and signal transduction
Reactome : Netrin-1 signaling
Reactome : PCP/CE pathway
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of actin dynamics for phagocytic cup formation
Reactome : SEMA3A-Plexin repulsion signaling by inhibiting Integrin adhesion
Reactome : Sema3A PAK dependent Axon repulsion
Reactome : Sema4D in semaphorin signaling
Reactome : Sema4D induced cell migration and growth-cone collapse
Reactome : Sema4D mediated inhibition of cell attachment and migration
Reactome : Semaphorin interactions
Reactome : Signal Transduction
Reactome : Signal transduction by L1
Reactome : Signaling by GPCR
Reactome : Signaling by Robo receptor
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Wnt
Reactome : Signalling by NGF
Reactome : The role of Nef in HIV-1 replication and disease pathogenesis
Reactome : Translocation of GLUT4 to the plasma membrane
Reactome : beta-catenin independent WNT signaling
Reactome : p75 NTR receptor-mediated signalling
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : Androgen receptor signaling pathway
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Focal Adhesion
WikiPathway : G13 Signaling Pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Leptin signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : NOD pathway
WikiPathway : Physiological and Pathological Hypertrophy of the Heart
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TOR signaling
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : Wnt Signaling Pathway
WikiPathway : angiogenesis overview
WikiPathway : p38 MAPK Signaling Pathway

Clone

Cloning Information : 23877
HIP Master Clone ID : 54253
Original Clone ID : FLH023877.01X

Organism


TAX_ID : 9606
Species Specific ID: 5879

Genome

Chromosome : 7
Map Location : 7p22
Ensembl : ENSG00000136238

Reagents

Labome : Rac1-antibody