DNASU Plasmid Repository • 480.965.5697 | Email

ADM2 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ADM2
Gene Name:  adrenomedullin 2
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100000095)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00351278

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 696nts         Open reading frame : 1 to 696

ATGGTGGCCGCCAACACTCGGGCCCCCGAAGACACTCGGGCCCCCGCAGGACCCAAGCCC
AGCTCCTGCGAGTGGGCTGTGTGCTGGGCACCTGCCAGGTGCAGAATCTCAGCCACCGCC
TGTGGCAACTCATGGGACCGGCCGGCCGGCAGGACTCAGCTCCTGTGGACCCCAGCAGCC
CCCACAGCTATGGCTGAGGTGGGGCCGGGCCACACCCCTGCCCATCCCAGCCAGGGTGCT
GTGCCCCCGTCCAGAGCTGCAGCTGAGCCCCATCTGAAGCCCAGTCCCTCGGAGCTGCAG
ACAGCAGGTCCTGCAGCAACAATACCTGCACGGCTTTGCACACGTAAACCTAGGCTGGTC
TACACGCAGTGCTGGTACGTCAAGGAGCCTAAACACCCTGAAATTGTGACCCCCTGGGGG
ACAGCTGCCAGACACAGCTGGCGGCAGCACCAGATGCTAAGCGCTTCAGAGAGGAGGTGT
CTGCCCAGAGATGTGGAGCAGAAGCTGGGCCCTGAACACACGGGGCCATGTCTGGACGAG
CAGGGGAGAGAGGCTGAACTGGCCAGAAGTGGCCCCTCCGCTGCTGGTCCAGTCAGACTG
AAGCCCGGCCTTGTGCCTGGGCTGTTCCTGCTCTCATGCACAACCAGCCCTTCCACGTGC
CTGCCTGTGGGACAGGAGGGGGAGCGTGGGATGCTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ADM2
Symbol Nomenclature : ADM2
SYNONYM : AM2; dJ579N16.4
Designation : intermedin
Full Nomenclature : adrenomedullin 2
GENEID : 79924
Locus Tag : RP4-579N16.10-002
GenBank Accession : 563885
HGNC : 28898
MIM : 608682
Vega : OTTHUMG00000150202
Target GenBank: CU013317

 

Pathways

Reactome : Calcitonin-like ligand receptors
Reactome : Class B/2 (Secretin family receptors)
Reactome : G alpha (s) signalling events
Reactome : GPCR downstream signaling
Reactome : GPCR ligand binding
Reactome : Signal Transduction
Reactome : Signaling by GPCR

Protein

UniProt : Q7Z4H4
HPRD : 10563

Clone

Cloning Information : 563885

Organism


TAX_ID : 9606
Species Specific ID: 79924

Genome

Chromosome : 22
Map Location : 22q13.33
Ensembl : ENSG00000128165

Reagents

Labome : ADM2-antibody