DNASU Plasmid Repository • 480.965.5697 | Email

CCNO (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CCNO
Gene Name:  cyclin O
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100063977)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00351320

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1053nts         Open reading frame : 1 to 1053
Reference Sequence Alignment

ATGGTGACCCCCTGTCCCACCAGCCCCTCGAGCCCCGCCGCCCGAGCGGGGAGGCGGGAC
AACGACCAGAACCTTCGCGCCCCGGTGAAGAAGAGCAGGCGTCCGCGCCTCCGGAGGAAG
CAGCCGCTGCATCCCCTGAACCCGTGCCCGCTCCCGGGAGACTCCGGCATTTGCGACCTG
TTCGAGTCCCCCAGCTCCGGCTCAGACGGCGCAGAGAGCCCCTCTGCGGCGCGGGGTGGT
AGCCCCCTGCCCGGCCCGGCCCAGCCCGTGGCGCAGCTAGATCTACAGACCTTCCGCGAC
TACGGCCAGAGCTGCTACGCCTTCCGCAAGGCGCAGGAGAGCCACTTCCACCCGCGGGAG
GCGCTGGCACGGCAGCCACAAGTGACGGCGGAATCCCGCTGTAAGCTGCTCAGCTGGCTG
ATCCCGGTGCACCGCCAATTCGGCCTCTCCTTCGAGTCGCTGTGCCTGACGGTGAACACT
CTGGACCGCTTCCTCACCACCACGCCGGTGGCTGCAGACTGCTTCCAGCTGCTTGGGGTC
ACCTCCTTGCTCATCGCTTGCAAACAGGTGGAGGTGCACCCGCCGCGCGTGAAGCAGCTT
CTGGCCCTCTGCTGCGGCGCCTTCTCCCGGCAGCAGCTCTGCAACCTCGAGTGCATCGTG
CTGCACAAGCTGCACTTCACCCTGGGTGCGCCCACCATTAGCTTCTTCCTGGAGCATTTC
ACGCACGCTCGCGTGGAGGCGGGGCAGGCTGAGGCCTCCGAAGCTCTGGAAGCGCAAGCC
CTGGCGCGGGGGGTGGCAGAGCTGAGTCTGGCCGACTATGCCTTCACCAGCTACTCCCCT
TCCCTCCTGGCGATCTGCTGCCTGGCGCTGGCGGACCGCATGCTGCGGGTCTCGCGGCCC
GTGGACTTGCGACTGGGAGACCACCCGGAGGCGGCGCTGGAGGACTGTATGGGCAAGTTG
CAGCTGCTGGTGGCCATAAACAGTACTTCCTTGACTCACATGCTGCCCGTTCAGATCTGC
GAGAAGTGCAGCCTGCCCCCGAGCTCGAAATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CCNO
Symbol Nomenclature : CCNO
SYNONYM : CCNU; UDG2
Designation : cyclin U|cyclin domain containing|cyclin-O
Full Nomenclature : cyclin O
GENEID : 10309
GenBank Accession : 563927
HGNC : 18576
MIM : 607752
Vega : OTTHUMG00000162598
Target GenBank: BC160041

 

Reference Sequence Alignment

  

HsCD00351320      ATGGTGACCCCCTGTCCCACCAGCCCCTCGAGCCCCGCCGCCCGAGCGGGGAGGCGGGAC
NM_021147.3       ATGGTGACCCCCTGTCCCACCAGCCCCTCGAGCCCCGCCGCCCGAGCGGGGAGGCGGGAC
                  ************************************************************

HsCD00351320      AACGACCAGAACCTTCGCGCCCCGGTGAAGAAGAGCAGGCGTCCGCGCCTCCGGAGGAAG
NM_021147.3       AACGACCAGAACCTTCGCGCCCCGGTGAAGAAGAGCAGGCGTCCGCGCCTCCGGAGGAAG
                  ************************************************************

HsCD00351320      CAGCCGCTGCATCCCCTGAACCCGTGCCCGCTCCCGGGAGACTCCGGCATTTGCGACCTG
NM_021147.3       CAGCCGCTGCATCCCCTGAACCCGTGCCCGCTCCCGGGAGACTCCGGCATTTGCGACCTG
                  ************************************************************

HsCD00351320      TTCGAGTCCCCCAGCTCCGGCTCAGACGGCGCAGAGAGCCCCTCTGCGGCGCGGGGTGGT
NM_021147.3       TTCGAGTCCCCCAGCTCCGGCTCAGACGGCGCAGAGAGCCCCTCTGCGGCGCGGGGTGGT
                  ************************************************************

HsCD00351320      AGCCCCCTGCCCGGCCCGGCCCAGCCCGTGGCGCAGCTAGATCTACAGACCTTCCGCGAC
NM_021147.3       AGCCCCCTGCCCGGCCCGGCCCAGCCCGTGGCGCAGCTAGATCTACAGACCTTCCGCGAC
                  ************************************************************

HsCD00351320      TACGGCCAGAGCTGCTACGCCTTCCGCAAGGCGCAGGAGAGCCACTTCCACCCGCGGGAG
NM_021147.3       TACGGCCAGAGCTGCTACGCCTTCCGCAAGGCGCAGGAGAGCCACTTCCACCCGCGGGAG
                  ************************************************************

HsCD00351320      GCGCTGGCACGGCAGCCACAAGTGACGGCGGAATCCCGCTGTAAGCTGCTCAGCTGGCTG
NM_021147.3       GCGCTGGCACGGCAGCCACAAGTGACGGCGGAATCCCGCTGTAAGCTGCTCAGCTGGCTG
                  ************************************************************

HsCD00351320      ATCCCGGTGCACCGCCAATTCGGCCTCTCCTTCGAGTCGCTGTGCCTGACGGTGAACACT
NM_021147.3       ATCCCGGTGCACCGCCAATTCGGCCTCTCCTTCGAGTCGCTGTGCCTGACGGTGAACACT
                  ************************************************************

HsCD00351320      CTGGACCGCTTCCTCACCACCACGCCGGTGGCTGCAGACTGCTTCCAGCTGCTTGGGGTC
NM_021147.3       CTGGACCGCTTCCTCACCACCACGCCGGTGGCTGCAGACTGCTTCCAGCTGCTTGGGGTC
                  ************************************************************

HsCD00351320      ACCTCCTTGCTCATCGCTTGCAAACAGGTGGAGGTGCACCCGCCGCGCGTGAAGCAGCTT
NM_021147.3       ACCTCCTTGCTCATCGCTTGCAAACAGGTGGAGGTGCACCCGCCGCGCGTGAAGCAGCTT
                  ************************************************************

HsCD00351320      CTGGCCCTCTGCTGCGGCGCCTTCTCCCGGCAGCAGCTCTGCAACCTCGAGTGCATCGTG
NM_021147.3       CTGGCCCTCTGCTGCGGCGCCTTCTCCCGGCAGCAGCTCTGCAACCTCGAGTGCATCGTG
                  ************************************************************

HsCD00351320      CTGCACAAGCTGCACTTCACCCTGGGTGCGCCCACCATTAGCTTCTTCCTGGAGCATTTC
NM_021147.3       CTGCACAAGCTGCACTTCACCCTGGGTGCGCCCACCATTAGCTTCTTCCTGGAGCATTTC
                  ************************************************************

HsCD00351320      ACGCACGCTCGCGTGGAGGCGGGGCAGGCTGAGGCCTCCGAAGCTCTGGAAGCGCAAGCC
NM_021147.3       ACGCACGCTCGCGTGGAGGCGGGGCAGGCTGAGGCCTCCGAAGCTCTGGAAGCGCAAGCC
                  ************************************************************

HsCD00351320      CTGGCGCGGGGGGTGGCAGAGCTGAGTCTGGCCGACTATGCCTTCACCAGCTACTCCCCT
NM_021147.3       CTGGCGCGGGGGGTGGCAGAGCTGAGTCTGGCCGACTATGCCTTCACCAGCTACTCCCCT
                  ************************************************************

HsCD00351320      TCCCTCCTGGCGATCTGCTGCCTGGCGCTGGCGGACCGCATGCTGCGGGTCTCGCGGCCC
NM_021147.3       TCCCTCCTGGCGATCTGCTGCCTGGCGCTGGCGGACCGCATGCTGCGGGTCTCGCGGCCC
                  ************************************************************

HsCD00351320      GTGGACTTGCGACTGGGAGACCACCCGGAGGCGGCGCTGGAGGACTGTATGGGCAAGTTG
NM_021147.3       GTGGACTTGCGACTGGGAGACCACCCGGAGGCGGCGCTGGAGGACTGTATGGGCAAGTTG
                  ************************************************************

HsCD00351320      CAGCTGCTGGTGGCCATAAACAGTACTTCCTTGACTCACATGCTGCCCGTTCAGATCTGC
NM_021147.3       CAGCTGCTGGTGGCCATAAACAGTACTTCCTTGACTCACATGCTGCCCGTTCAGATCTGC
                  ************************************************************

HsCD00351320      GAGAAGTGCAGCCTGCCCCCGAGCTCGAAATAG
NM_021147.3       GAGAAGTGCAGCCTGCCCCCGAGCTCGAAATAA
                  ********************************.

Pathways

Reactome : Base Excision Repair
Reactome : Base-Excision Repair, AP Site Formation
Reactome : Base-free sugar-phosphate removal via the single-nucleotide replacement pathway
Reactome : Cleavage of the damaged pyrimidine
Reactome : DNA Repair
Reactome : Depyrimidination
Reactome : Displacement of DNA glycosylase by APE1
Reactome : Recognition and association of DNA glycosylase with site containing an affected pyrimidine
Reactome : Removal of DNA patch containing abasic residue
Reactome : Resolution of AP sites via the multiple-nucleotide patch replacement pathway
Reactome : Resolution of AP sites via the single-nucleotide replacement pathway
Reactome : Resolution of Abasic Sites (AP sites)

Clone

Cloning Information : 563927

Organism


TAX_ID : 9606
Species Specific ID: 10309

Genome

Chromosome : 5
Map Location : 5q11.2
Ensembl : ENSG00000152669

Reagents

Labome : CCNO-antibody