DNASU Plasmid Repository • 480.965.5697 | Email

RHO (Homo sapiens) in pENTR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RHO
Gene Name:  rhodopsin
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR201               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100002303)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00351471

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1044nts         Open reading frame : 1 to 1044
Reference Sequence Alignment

ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTA
CGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTG
GCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTAC
GTCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCC
GTGGCTGACCTCTTCATGGTCCTAGGTGGCTTCACCAGCACCCTCTACACCTCTCTGCAT
GGATACTTCGTCTTCGGGCCCACAGGATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGC
GGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTGTGT
AAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCATGCCATCATGGGCGTTGCCTTCACC
TGGGTCATGGCGCTGGCCTGCGCCGCACCCCCACTCGCCGGCTGGTCCAGGTACATCCCC
GAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAACAAC
GAGTCTTTTGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTT
TTCTGCTATGGGCAGCTCGTCTTCACCGTCAAGGAGGCCGCTGCCCAGCAGCAGGAGTCA
GCCACCACACAGAAGGCAGAGAAGGAGGTCACCCGCATGGTCATCATCATGGTCATCGCT
TTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGCATTCTACATCTTCACCCACCAGGGC
TCCAACTTCGGTCCCATCTTCATGACCATCCCAGCGTTCTTTGCCAAGAGCGCCGCCATC
TACAACCCTGTCATCTATATCATGATGAACAAGCAGTTCCGGAACTGCATGCTCACCACC
ATCTGCTGCGGCAAGAACCCACTGGGTGACGATGAGGCCTCTGCTACCGTGTCCAAGACG
GAGACGAGCCAGGTGGCCCCGGCC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR201

pENTR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; kanamycin resistance; recombinational cloning.
Comments: derived from pDONR201, available from Invitrogen Corp. More information can be found here http://orfeomecollaboration.org/vectors.php
Size (bp): 2294
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC bacterial origin of replication 1629 2268
primer pDONR201-forward pDONR201-forward sequencing primer GTAACATCAGAGATTTTGAGACAC 570 593
primer pDONR201-reverse pDONR201-reverse sequencing primer TCGCGTTAACGCTAGCATGGATCTC 307 331
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only 488 576
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only 418 338
selectable marker KanR Kanamycin resistance gene 699 1508
trxn termination sequence rrnB T1-T2 rrnb RNA termination 322 56

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RHO
Symbol Nomenclature : RHO
SYNONYM : CSNBAD1; OPN2; RP4
Designation : opsin 2, rod pigment|opsin-2
Full Nomenclature : rhodopsin
GENEID : 6010
GenBank Accession : 564078
HGNC : 10012
MIM : 180380
Vega : OTTHUMG00000159542
Target GenBank: AM392780

 

Reference Sequence Alignment

  

HsCD00351471      ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTA
NM_000539.3       ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTA
                  ************************************************************

HsCD00351471      CGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTG
NM_000539.3       CGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTG
                  ************************************************************

HsCD00351471      GCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTAC
NM_000539.3       GCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTAC
                  ************************************************************

HsCD00351471      GTCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCC
NM_000539.3       GTCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCC
                  ************************************************************

HsCD00351471      GTGGCTGACCTCTTCATGGTCCTAGGTGGCTTCACCAGCACCCTCTACACCTCTCTGCAT
NM_000539.3       GTGGCTGACCTCTTCATGGTCCTAGGTGGCTTCACCAGCACCCTCTACACCTCTCTGCAT
                  ************************************************************

HsCD00351471      GGATACTTCGTCTTCGGGCCCACAGGATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGC
NM_000539.3       GGATACTTCGTCTTCGGGCCCACAGGATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGC
                  ************************************************************

HsCD00351471      GGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTGTGT
NM_000539.3       GGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTGTGT
                  ************************************************************

HsCD00351471      AAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCATGCCATCATGGGCGTTGCCTTCACC
NM_000539.3       AAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCATGCCATCATGGGCGTTGCCTTCACC
                  ************************************************************

HsCD00351471      TGGGTCATGGCGCTGGCCTGCGCCGCACCCCCACTCGCCGGCTGGTCCAGGTACATCCCC
NM_000539.3       TGGGTCATGGCGCTGGCCTGCGCCGCACCCCCACTCGCCGGCTGGTCCAGGTACATCCCC
                  ************************************************************

HsCD00351471      GAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAACAAC
NM_000539.3       GAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAACAAC
                  ************************************************************

HsCD00351471      GAGTCTTTTGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTT
NM_000539.3       GAGTCTTTTGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTT
                  ************************************************************

HsCD00351471      TTCTGCTATGGGCAGCTCGTCTTCACCGTCAAGGAGGCCGCTGCCCAGCAGCAGGAGTCA
NM_000539.3       TTCTGCTATGGGCAGCTCGTCTTCACCGTCAAGGAGGCCGCTGCCCAGCAGCAGGAGTCA
                  ************************************************************

HsCD00351471      GCCACCACACAGAAGGCAGAGAAGGAGGTCACCCGCATGGTCATCATCATGGTCATCGCT
NM_000539.3       GCCACCACACAGAAGGCAGAGAAGGAGGTCACCCGCATGGTCATCATCATGGTCATCGCT
                  ************************************************************

HsCD00351471      TTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGCATTCTACATCTTCACCCACCAGGGC
NM_000539.3       TTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGCATTCTACATCTTCACCCACCAGGGC
                  ************************************************************

HsCD00351471      TCCAACTTCGGTCCCATCTTCATGACCATCCCAGCGTTCTTTGCCAAGAGCGCCGCCATC
NM_000539.3       TCCAACTTCGGTCCCATCTTCATGACCATCCCAGCGTTCTTTGCCAAGAGCGCCGCCATC
                  ************************************************************

HsCD00351471      TACAACCCTGTCATCTATATCATGATGAACAAGCAGTTCCGGAACTGCATGCTCACCACC
NM_000539.3       TACAACCCTGTCATCTATATCATGATGAACAAGCAGTTCCGGAACTGCATGCTCACCACC
                  ************************************************************

HsCD00351471      ATCTGCTGCGGCAAGAACCCACTGGGTGACGATGAGGCCTCTGCTACCGTGTCCAAGACG
NM_000539.3       ATCTGCTGCGGCAAGAACCCACTGGGTGACGATGAGGCCTCTGCTACCGTGTCCAAGACG
                  ************************************************************

HsCD00351471      GAGACGAGCCAGGTGGCCCCGGCC---
NM_000539.3       GAGACGAGCCAGGTGGCCCCGGCCTAA
                  ************************   

Pathways

NCI : Visual signal transduction: Rods
Panther : Heterotrimeric G-protein signaling pathway-rod outer segment phototransduction
Reactome : Activation of the phototransduction cascade
Reactome : Class A/1 (Rhodopsin-like receptors)
Reactome : Disease
Reactome : Diseases associated with visual transduction
Reactome : G alpha (i) signalling events
Reactome : GPCR downstream signaling
Reactome : GPCR ligand binding
Reactome : Inactivation, recovery and regulation of the phototransduction cascade
Reactome : Opsins
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : The canonical retinoid cycle in rods (twilight vision)
Reactome : The phototransduction cascade
Reactome : Visual phototransduction
WikiPathway : GPCRs, Class A Rhodopsin-like
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrin-mediated cell adhesion

Protein

UniProt : P08100
HPRD : 01584

Clone

Cloning Information : 564078

Organism


TAX_ID : 9606
Species Specific ID: 6010

Genome

Chromosome : 3
Map Location : 3q21-q24
Ensembl : ENSG00000163914

Reagents

Labome : rhodopsin-antibody