DNASU Plasmid Repository • 480.965.5697 | Email

H3F3B (Homo sapiens) in pENTR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  H3F3B
Gene Name:  H3 histone, family 3B (H3.3B)
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR201               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100002304)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00351478

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 408nts         Open reading frame : 1 to 408
Reference Sequence Alignment

ATGGCCCGAACCAAGCAGACTGCTCGTAAGTCCACCGGTGGGAAAGCCCCCCGCAAACAG
CTGGCCACGAAAGCCGCCAGGAAAAGCGCTCCCTCTACCGGCGGGGTGAAGAAGCCTCAT
CGCTACAGGCCCGGGACCGTGGCGCTTCGAGAGATTCGTCGTTATCAGAAGTCGACCGAG
CTGCTCATCCGGAAGCTGCCCTTCCAGAGGTTGGTGAGGGAGATCGCGCAGGATTTCAAA
ACCGACCTGAGGTTTCAGAGCGCAGCCATCGGTGCGCTGCAGGAGGCTAGCGAAGCGTAC
CTGGTGGGTCTGTTCGAAGATACCAACCTGTGTGCCATCCACGCTAAGAGAGTCACCATC
ATGCCCAAAGACATCCAGTTGGCTCGCCGGATACGGGGAGAGAGAGCT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR201

pENTR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; kanamycin resistance; recombinational cloning.
Comments: derived from pDONR201, available from Invitrogen Corp. More information can be found here http://orfeomecollaboration.org/vectors.php
Size (bp): 2294
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC bacterial origin of replication 1629 2268
primer pDONR201-forward pDONR201-forward sequencing primer GTAACATCAGAGATTTTGAGACAC 570 593
primer pDONR201-reverse pDONR201-reverse sequencing primer TCGCGTTAACGCTAGCATGGATCTC 307 331
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only 488 576
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only 418 338
selectable marker KanR Kanamycin resistance gene 699 1508
trxn termination sequence rrnB T1-T2 rrnb RNA termination 322 56

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : H3F3B
Symbol Nomenclature : H3F3B
SYNONYM : H3.3B
Designation : H3 histone, family 3A|histone H3.3
Full Nomenclature : H3 histone, family 3B (H3.3B)
GENEID : 3021
GenBank Accession : 564085
HGNC : 4765
MIM : 601058
Vega : OTTHUMG00000179842
Target GenBank: AM393192

 

Reference Sequence Alignment

  

HsCD00351478        ATGGCCCGAACCAAGCAGACTGCTCGTAAGTCCACCGGTGGGAAAGCCCCCCGCAAACAG
NM_003536.2         ATGGCGCGTACGAAGCAGACTGCTCGCAAGTCCACCGGCGGCAAGGCTCCGCGCAAGCAG
NM_003493.2         ATGGCCCGAACCAAGCAGACTGCGCGCAAGTCAACGGGTGGCAAGGCGCCGCGCAAGCAG
NM_003530.4         ATGGCTCGTACCAAGCAGACTGCTCGCAAGTCCACGGGTGGGAAAGCGCCACGCAAGCAG
NM_021018.2         ATGGCACGCACGAAGCAAACAGCTCGTAAGTCCACTGGCGGCAAAGCCCCGCGCAAGCAG
NM_003531.2         ATGGCTCGTACGAAGCAAACAGCTCGCAAGTCTACCGGCGGCAAAGCTCCGCGCAAGCAG
NM_003537.3         ATGGCTCGTACTAAACAGACAGCTCGGAAATCCACCGGCGGTAAAGCGCCACGCAAGCAG
NM_002107.4         ATGGCTCGTACAAAGCAGACTGCCCGCAAATCGACCGGTGGTAAAGCACCCAGGAAGCAA
NM_003529.2         ATGGCTCGCACTAAGCAAACTGCTCGGAAGTCTACTGGTGGCAAGGCGCCACGCAAACAG
NM_001005464.2      ATGGCCCGTACTAAGCAGACTGCTCGCAAGTCGACCGGCGGCAAGGCCCCGAGGAAGCAG
NM_003535.2         ATGGCCCGGACGAAGCAGACAGCTCGCAAGTCTACCGGCGGCAAGGCACCGCGGAAGCAG
NM_003533.2         ATGGCACGAACAAAGCAAACAGCTCGCAAGTCCACCGGCGGCAAAGCGCCGCGCAAGCAG
NM_003534.2         ATGGCCCGCACCAAGCAGACTGCACGCAAGTCCACCGGTGGCAAAGCGCCGCGCAAGCAG
NM_001013699.2      ATGGCCCGAACCAAGCAGACTGCTCGTAAATCCACCGGTGGGAAAGCCCCCCGCAAACAG
NM_005324.3         ATGGCCCGAACCAAGCAGACTGCTCGTAAGTCCACCGGTGGGAAAGCCCCCCGCAAACAG
NM_001123375.2      ATGGCCCGTACTAAGCAGACTGCCCGCAAGTCGACCGGCGGCAAGGCCCCGAGGAAGCAG
NM_003532.2         ATGGCGCGTACTAAGCAGACGGCTCGTAAATCCACAGGCGGTAAAGCACCGCGCAAACAG
NM_021059.2         ATGGCCCGTACTAAGCAGACTGCTCGCAAGTCGACCGGCGGCAAGGCCCCGAGGAAGCAG
                    ***** ** ** **.**.** ** ** **.** ** ** ** **.** ** .* **.**.

HsCD00351478        CTGGCCACGAAAGCCGCCAGGAAAAGCGCTCCCTCTACCGGCGGGGTGAAGAAGCCTCAT
NM_003536.2         CTGGCCACCAAGGCGGCTCGGAAGAGCGCTCCGGCCACCGGCGGTGTCAAGAAGCCCCAT
NM_003493.2         CTGGCCACCAAGGTGGCTCGCAAGAGCGCACCTGCCACTGGCGGCGTGAAGAAGCCGCAC
NM_003530.4         CTGGCCACCAAGGCTGCTCGAAAGAGCGCTCCAGCCACCGGCGGCGTGAAGAAGCCCCAC
NM_021018.2         CTGGCCACTAAGGCGGCTCGCAAAAGCGCGCCAGCCACCGGTGGCGTGAAGAAGCCCCAC
NM_003531.2         CTTGCTACTAAAGCAGCCCGTAAGAGCGCTCCGGCCACCGGTGGCGTGAAGAAACCTCAT
NM_003537.3         CTGGCTACCAAGGCTGCTCGCAAGAGCGCGCCGGCTACCGGCGGCGTGAAAAAGCCTCAC
NM_002107.4         CTGGCTACAAAAGCCGCTCGCAAGAGTGCGCCCTCTACTGGAGGGGTGAAGAAACCTCAT
NM_003529.2         TTGGCCACTAAGGCAGCCCGCAAAAGCGCTCCGGCCACCGGCGGCGTGAAAAAGCCCCAC
NM_001005464.2      CTGGCCACCAAGGCGGCCCGCAAGAGCGCGCCGGCCACGGGCGGGGTGAAGAAGCCGCAC
NM_003535.2         CTGGCCACCAAGGCAGCGCGCAAAAGCGCTCCAGCGACTGGCGGTGTGAAGAAGCCCCAC
NM_003533.2         CTGGCCACCAAGGCGGCTCGCAAGAGCGCTCCGGCCACCGGTGGCGTCAAGAAGCCCCAC
NM_003534.2         CTGGCCACTAAGGCGGCTCGGAAAAGCGCGCCGGCCACCGGCGGCGTGAAGAAACCTCAT
NM_001013699.2      CTGGCCACGAAAGCTGCCAGGAAAAGCACCCCCTCTACCTGCGGGGT---GAAGCCTCAT
NM_005324.3         CTGGCCACGAAAGCCGCCAGGAAAAGCGCTCCCTCTACCGGCGGGGTGAAGAAGCCTCAT
NM_001123375.2      CTGGCTACCAAAGCGGCCCGCAAGAGCGCGCCGGCCACGGGCGGGGTGAAGAAGCCGCAC
NM_003532.2         CTGGCCACTAAGGCAGCTCGCAAGAGCGCTCCGGCCACGGGCGGCGTGAAGAAGCCCCAT
NM_021059.2         CTGGCCACCAAGGCGGCCCGCAAGAGCGCGCCGGCCACGGGCGGGGTGAAGAAGCCGCAC
                     * ** ** **.*  ** .* **.** .* **  * **  * ** **   .**.** ** 

HsCD00351478        CGCTACAGGCCCGGGACCGTGGCGCTTCGAGAGATTCGTCGTTATCAGAAGTCGACCGAG
NM_003536.2         CGCTATCGGCCTGGTACAGTGGCTCTCCGCGAGATTCGCCGCTACCAGAAGTCCACCGAG
NM_003493.2         CGCTACCGGCCCGGCACGGTGGCGCTTCGCGAGATCCGCCGCTACCAGAAGTCCACTGAG
NM_003530.4         CGTTACCGGCCCGGCACGGTGGCTCTGCGCGAGATCCGCCGCTACCAGAAGTCGACCGAG
NM_021018.2         CGCTACAGGCCTGGTACTGTCGCCCTCCGTGAAATCCGCCGCTATCAGAAATCGACTGAG
NM_003531.2         CGCTACCGCCCGGGCACCGTGGCCTTGCGCGAAATCCGTCGCTACCAGAAGTCCACCGAG
NM_003537.3         CGTTACCGCCCGGGCACTGTGGCTCTGCGCGAGATCCGCCGCTACCAAAAGTCGACCGAG
NM_002107.4         CGTTACAGGCCTGGTACTGTGGCGCTCCGTGAAATTAGACGTTATCAGAAGTCCACTGAA
NM_003529.2         CGCTACCGGCCGGGCACCGTGGCTCTGCGCGAGATCCGCCGTTATCAGAAGTCCACTGAA
NM_001005464.2      CGCTACCGGCCCGGCACCGTAGCCCTGCGGGAGATCCGGCGCTACCAGAAGTCCACGGAG
NM_003535.2         CGCTACAGGCCAGGCACCGTGGCCTTGCGTGAGATCCGCCGTTATCAGAAGTCGACTGAG
NM_003533.2         CGCTACCGCCCCGGCACCGTGGCCCTGCGCGAGATCCGCCGCTACCAGAAGTCGACCGAG
NM_003534.2         CGCTACCGTCCCGGCACCGTGGCTCTGCGCGAGATTCGCCGCTATCAGAAGTCGACTGAG
NM_001013699.2      CGCTACAGGCCTGGGACCGTGGCGCTTCGAGAGATTCGTCGTTATCAGAAGTCGACCGAG
NM_005324.3         CGCTACAGGCCCGGGACCGTGGCGCTTCGAGAGATTCGTCGTTATCAGAAGTCGACCGAG
NM_001123375.2      CGCTACCGGCCCGGCACCGTGGCTCTGCGGGAGATCCGGCGCTACCAGAAGTCTACGGAG
NM_003532.2         CGCTACCGCCCTGGCACCGTGGCTCTGCGCGAGATCCGTCGCTACCAGAAGTCTACCGAG
NM_021059.2         CGCTACCGGCCCGGCACCGTAGCCCTGCGGGAGATCCGGCGCTACCAGAAGTCCACGGAG
                    ** ** .* ** ** ** ** **  * ** **.** .* ** ** **.**.** ** **.

HsCD00351478        CTGCTCATCCGGAAGCTGCCCTTCCAGAGGTTGGTGAGGGAGATCGCGCAGGATTTCAAA
NM_003536.2         CTGCTGATCAGAAAGCTGCCTTTTCAGCGTCTGGTGCGTGAGATCGCGCAGGACTTCAAG
NM_003493.2         CTGCTAATCCGCAAGTTGCCCTTCCAGCGGCTGATGCGCGAGATCGCTCAGGACTTTAAG
NM_003530.4         CTGCTGATTCGCAAACTGCCATTCCAGCGTCTAGTCCGTGAGATCGCGCAGGACTTCAAG
NM_021018.2         CTACTGATTCGCAAGCTACCATTCCAGCGTCTGGTACGTGAGATCGCGCAGGACTTCAAG
NM_003531.2         CTGCTGATCCGGAAGCTGCCGTTCCAGCGCCTGGTGCGAGAAATCGCCCAGGACTTCAAA
NM_003537.3         TTGCTGATTCGGAAGCTGCCGTTCCAGCGCCTGGTGCGAGAAATCGCCCAAGACTTCAAG
NM_002107.4         CTTCTGATTCGCAAACTTCCCTTCCAGCGTCTGGTGCGAGAAATTGCTCAGGACTTTAAA
NM_003529.2         CTGCTTATTCGTAAACTACCTTTCCAGCGCCTGGTGCGCGAGATTGCGCAGGACTTTAAA
NM_001005464.2      CTGCTGATCCGCAAGCTGCCCTTCCAGCGGCTGGTACGCGAGATCGCGCAGGACTTTAAG
NM_003535.2         CTGCTCATCCGCAAACTGCCATTTCAGCGCCTGGTGCGAGAAATCGCGCAGGATTTCAAA
NM_003533.2         CTGCTAATCCGGAAGCTACCTTTTCAGCGCTTGGTACGGGAGATCGCACAGGACTTTAAG
NM_003534.2         CTGCTGATCCGCAAGTTGCCTTTCCAACGCCTGGTGCGAGAAATCGCTCAGGACTTCAAG
NM_001013699.2      CTGCTCATCCGGAAGCTGCCCTTCCAGAGGTTGGTGAGGGAGATCGCGCAGGATTTCAAC
NM_005324.3         CTGCTCATCCGGAAGCTGCCCTTCCAGAGGTTGGTGAGGGAGATCGCGCAGGATTTCAAA
NM_001123375.2      CTGCTGATCCGCAAGCTGCCCTTCCAGCGGCTGGTACGCGAGATCGCGCAGGACTTTAAG
NM_003532.2         CTTCTAATCCGGAAGCTGCCGTTTCAGCGCCTGGTGCGAGAAATAGCTCAGGACTTCAAG
NM_021059.2         CTGCTGATCCGCAAGCTGCCCTTCCAGCGGCTGGTACGCGAGATCGCGCAGGACTTTAAG
                     * ** ** .* **. * ** ** **..*  *..* .* **.** ** **.** ** ** 

HsCD00351478        ACCGACCTGAGGTTTCAGAGCGCAGCCATCGGTGCGCTGCAGGAGGCTAGCGAAGCGTAC
NM_003536.2         ACCGACTTGCGCTTCCAGAGCTCCGCGGTGATGGCGCTGCAAGAGGCATGCGAGGCCTAC
NM_003493.2         ACCGACCTGCGCTTCCAGAGCTCGGCCGTGATGGCGCTGCAGGAGGCGTGCGAGTCTTAC
NM_003530.4         ACTGATCTGCGTTTTCAGAGCTCGGCGGTGATGGCGCTGCAGGAGGCCTGCGAGGCCTAC
NM_021018.2         ACCGACCTGCGCTTCCAGAGCTCGGCTGTGATGGCGCTGCAGGAGGCCTGCGAGGCTTAC
NM_003531.2         ACCGACCTGCGTTTCCAGAGCTCTGCGGTGATGGCGCTGCAGGAGGCTTGTGAGGCCTAC
NM_003537.3         ACCGATCTTCGCTTCCAGAGCTCTGCGGTGATGGCGCTGCAGGAGGCTTGTGAGGCCTAC
NM_002107.4         ACAGATCTGCGCTTCCAGAGCGCAGCTATCGGTGCTTTGCAGGAGGCAAGTGAGGCCTAT
NM_003529.2         ACAGACCTGCGTTTCCAGAGCTCCGCTGTGATGGCTCTGCAGGAGGCGTGCGAGGCCTAC
NM_001005464.2      ACGGACCTGCGCTTCCAGAGCTCGGCCGTGATGGCGCTGCAGGAGGCCAGCGAGGCCTAC
NM_003535.2         ACCGACCTTCGTTTCCAGAGCTCGGCGGTGATGGCGCTGCAAGAGGCGTGCGAGGCCTAT
NM_003533.2         ACCGATCTGCGCTTCCAGAGCTCGGCGGTGATGGCGCTGCAGGAGGCTTGCGAGGCCTAC
NM_003534.2         ACAGATCTGCGCTTTCAGAGTTCCGCGGTGATGGCCCTGCAGGAGGCCTGCGAGGCCTAC
NM_001013699.2      ACTGACCTGAGGTTTCAGAGCGCAGCCGTCGGTGCGCTGCAGGAGGCTAGCGAAGCGTAC
NM_005324.3         ACCGACCTGAGGTTTCAGAGCGCAGCCATCGGTGCGCTGCAGGAGGCTAGCGAAGCGTAC
NM_001123375.2      ACGGACCTGCGCTTCCAGAGCTCGGCCGTGATGGCGCTGCAGGAGGCCAGCGAGGCCTAC
NM_003532.2         ACCGACCTGCGCTTCCAGAGTTCCGCGGTGATGGCGCTGCAGGAGGCCTGCGAGGCCTAC
NM_021059.2         ACGGACCTGCGCTTCCAGAGCTCGGCCGTGATGGCGCTGCAGGAGGCCAGCGAGGCCTAC
                    ** **  * .* ** *****  * ** .* .  **  ****.***** :* **. * ** 

HsCD00351478        CTGGTGGGTCTGTTCGAAGATACCAACCTGTGTGCCATCCACGCTAAGAGAGTCACCATC
NM_003536.2         CTGGTGGGGCTCTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGGGTGACTATC
NM_003493.2         CTGGTGGGGCTGTTTGAGGACACCAACCTGTGTGTCATCCATGCCAAACGGGTCACCATC
NM_003530.4         CTGGTGGGGCTGTTTGAGGACACCAACCTATGCGCCATTCACGCCAAGCGAGTGACTATC
NM_021018.2         CTGGTGGGGCTCTTTGAGGACACCAACCTGTGTGCTATCCACGCCAAGCGAGTGACTATC
NM_003531.2         CTGGTGGGACTCTTCGAAGACACCAATCTGTGCGCTATTCACGCTAAACGCGTCACCATC
NM_003537.3         TTGGTAGGGCTCTTTGAGGACACAAACCTTTGCGCCATCCATGCTAAGCGAGTGACTATT
NM_002107.4         CTGGTTGGCCTTTTTGAAGACACCAACCTGTGTGCTATCCATGCCAAACGTGTAACAATT
NM_003529.2         TTGGTAGGGCTATTTGAGGACACTAACCTGTGCGCCATCCACGCCAAGCGCGTCACTATC
NM_001005464.2      CTGGTGGGGCTGTTCGAAGACACGAACCTGTGCGCCATCCACGCCAAGCGCGTGACCATT
NM_003535.2         CTGGTGGGTCTCTTTGAAGACACCAACCTCTGTGCTATTCACGCCAAGCGTGTCACTATT
NM_003533.2         CTGGTGGGGCTATTTGAGGATACCAACCTGTGCGCCATTCACGCCAAACGCGTCACTATT
NM_003534.2         TTGGTGGGGCTCTTTGAGGATACCAACCTGTGTGCCATCCATGCTAAGCGAGTGACTATC
NM_001013699.2      CTGGTGGGTCTGTTGGAAGATACTAACCTGTGTGCCATCCACGCTAAGAGAGTCACCATC
NM_005324.3         CTGGTGGGTCTGTTCGAAGATACCAACCTGTGTGCCATCCACGCTAAGAGAGTCACCATC
NM_001123375.2      CTGGTGGGGCTGTTCGAAGACACGAACCTGTGCGCCATCCATGCCAAGCGCGTGACCATC
NM_003532.2         TTGGTGGGGCTTTTCGAGGACACCAACCTGTGCGCTATTCATGCCAAACGCGTGACCATC
NM_021059.2         CTGGTGGGGCTGTTCGAAGACACGAACCTGTGCGCCATCCACGCCAAGCGCGTGACCATT
                     **** ** ** ** **.** ** ** ** ** *  ** ** ** **..* ** ** ** 

HsCD00351478        ATGCCCAAAGACATCCAGTTGGCTCGCCGGATACGGGGAGAGAGAGCT---
NM_003536.2         ATGCCCAAGGACATCCAGCTCGCACGTCGTATCCGCGGCGAGAGGGCTTGA
NM_003493.2         ATGCCTAAGGACATCCAGCTGGCACGCCGTATCCGCGGGGAGCGGGCCTAG
NM_003530.4         ATGCCCAAGGACATCCAGCTTGCTCGCCGCATTCGTGGGGAGAGGGCGTAA
NM_021018.2         ATGCCCAAGGACATCCAGCTCGCTCGCCGCATTCGCGGAGAGAGGGCATAA
NM_003531.2         ATGCCCAAAGATATCCAGCTGGCACGTCGCATCCGTGGGGAAAGGGCATAA
NM_003537.3         ATGCCCAAAGACATCCAGCTCGCTCGCCGCATTCGCGGAGAAAGAGCGTAA
NM_002107.4         ATGCCAAAAGACATCCAGCTAGCACGCCGCATACGTGGAGAACGTGCTTAA
NM_003529.2         ATGCCCAAGGACATCCAGCTCGCCCGCCGCATCCGCGGAGAGAGGGCGTGA
NM_001005464.2      ATGCCCAAGGACATCCAGCTGGCCCGCCGCATCCGTGGAGAGCGGGCTTAA
NM_003535.2         ATGCCTAAGGACATCCAGCTTGCGCGTCGTATCCGTGGCGAGCGAGCATAA
NM_003533.2         ATGCCTAAAGACATCCAGCTTGCGCGCCGCATCCGAGGGGAGAGGGCATAA
NM_003534.2         ATGCCCAAGGACATTCAGCTCGCTCGCCGCATTCGTGGGGAGAGAGCGTAG
NM_001013699.2      ATGCCCAAAGACATCCAGTTGGCTCGCCGGATACGGGGAGAGAGAGCTTAA
NM_005324.3         ATGCCCAAAGACATCCAGTTGGCTCGCCGGATACGGGGAGAGAGAGCTTAA
NM_001123375.2      ATGCCCAAGGACATCCAGTTGGCCCGCCGCATCCGCGGGGAGCGGGCCTAA
NM_003532.2         ATGCCTAAAGACATCCAGCTTGCCCGCCGCATTCGTGGGGAGAGGGCGTGA
NM_021059.2         ATGCCCAAGGACATCCAGCTGGCCCGCCGCATCCGTGGAGAGCGGGCTTAA
                    ***** **.** ** *** * ** ** ** ** ** ** **..* **    

Pathways

NCI : Aurora B signaling
NCI : Aurora C signaling

Protein

SMART domain : H3 : Histone H3
UniProt : B2R4P9
UniProt : P84243
HPRD : 03036

Clone

Cloning Information : 564085

Organism


TAX_ID : 9606
Species Specific ID: 3021

Genome

Chromosome : 17
Map Location : 17q25.1
Ensembl : ENSG00000132475

Reagents

Labome : H3F3B-antibody