DNASU Plasmid Repository • 480.965.5697 | Email

POLR1C (Homo sapiens) in pDONR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  POLR1C
Gene Name:  polymerase (RNA) I polypeptide C, 30kDa
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100071629)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00352167

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1038nts         Open reading frame : 1 to 1038
Reference Sequence Alignment

ATGGCGGCTTCTCAGGCGGTGGAGGAAATGCGGAGCCGCGTGGTTCTGGGGGAGTTTGGG
GTTCGCAATGTCCATACTACTGACTTTCCCGGTAACTATTCCGGTTATGATGATGCCTGG
GACCAGGACCGCTTCGAGAAGAATTTCCGTGTGGATGTAGTACACATGGATGAAAACTCA
CTGGAGTTTGACATGGTGGGAATTGACGCAGCCATTGCCAATGCTTTTCGACGAATTCTG
CTAGCTGAGGTGCCAACTATGGCTGTGGAGAAGGTCCTGGTGTACAATAATACATCCATT
GTTCAGGATGAGATTCTTGCTCACCGTCTGGGGCTCATTCCCATTCATGCTGATCCCCGT
CTTTTTGAGTATCGGAACCAAGGAGATGAAGAAGGCACAGAGATAGATACTCTACAGTTT
CGTCTCCAGGTCAGATGCACTCGGAACCCCCATGCTGCTAAAGATTCCTCTGACCCCAAC
GAACTGTACGTGAACCACAAAGTGTATACCAGGCATATGACATGGATCCCCCTGGGGAAC
CAGGCTGATCTCTTTCCAGAGGGCACTATCCGACCAGTGCATGATGATATCCTCATCGCT
CAGCTGCGGCCTGGCCAAGAAATTGACCTGCTCATGCACTGTGTCAAGGGCATTGGCAAA
GATCATGCCAAGTTTTCACCAGTGGCAACAGCCAGTTACAGGCTCCTGCCAGACATCACC
CTGCTTGAGCCCGTGGAAGGGGAGGCAGCTGAGGAGTTGAGCAGGTGCTTCTCACCTGGT
GTTATTGAGGTGCAGGAAGTCCAAGGTAAAAAGGTGGCCAGAGTTGCCAACCCCCGGCTG
GATACCTTCAGCAGAGAAATCTTCCGGAATGAGAAGCTAAAGAAGGTTGTGAGGCTTGCC
CGGGTTCGAGATCATTATATCTTCTCTGTTGAGTCAACGGGGGTGTTGCCACCAGATGTG
CTGGTGAGTGAAGCCATCAAAGTACTGATGGGGAAGTGCCGGCGCTTCTTGGATGAACTA
GATGCGGTTCAGATGGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR223

pDONR223 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Recombinational donor/master vector; spectinomycin resistance; recombinational cloning.
Comments: pDONR223 contains several improvements over the original Donor vector pDONR201. In pDONR223, the universal Forward (Fwd) and Reverse (Rev) sequencing primer sites flank the attP1 and attP2 recombination sites, the replication origin has been improved to increase copy number, and the selectable marker is spectinomycin resistance (instead of kanamycin resistance in pDONR201), which permits the use of either ampicillin or kanamycin resistance markers in Destination vectors.
Size (bp): 5005
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 bacterial origin 4339 4958
death cassette ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1200 1409
primer M13 forward M13 forward sequencing primer 536 553
primer M13 reverse M13 reverse sequencing primer 3020 3040
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only 569 652
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only 2896 2983
selectable marker SpectR spectinomycin resistance gene 3471 4262
trxn termination sequence rrnB rrnB T1 and T2 terminator 268 470

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : POLR1C
Symbol Nomenclature : POLR1C
SYNONYM : RPA39; RPA40; RPA5; RPAC1; TCS3
Designation : AC40|DNA-directed RNA polymerase I subunit C|DNA-directed RNA polymerases I and III 40 kDa polypeptide|DNA-directed RNA polymerases I and III subunit RPAC1|RNA polymerases I and III subunit AC1|RPC40
Full Nomenclature : polymerase (RNA) I polypeptide C, 30kDa
GENEID : 9533
Locus Tag : RP3-337H4.4
GenBank Accession : 564774
HGNC : 20194
MIM : 610060
Vega : OTTHUMG00000014739
Target GenBank: HQ448228

 

Reference Sequence Alignment

  

HsCD00352167      ATGGCGGCTTCTCAGGCGGTGGAGGAAATGCGGAGCCGCGTGGTTCTGGGGGAGTTTGGG
NM_203290.2       ATGGCGGCTTCTCAGGCGGTGGAGGAAATGCGGAGCCGCGTGGTTCTGGGGGAGTTTGGG
                  ************************************************************

HsCD00352167      GTTCGCAATGTCCATACTACTGACTTTCCCGGTAACTATTCCGGTTATGATGATGCCTGG
NM_203290.2       GTTCGCAATGTCCATACTACTGACTTTCCCGGTAACTATTCCGGTTATGATGATGCCTGG
                  ************************************************************

HsCD00352167      GACCAGGACCGCTTCGAGAAGAATTTCCGTGTGGATGTAGTACACATGGATGAAAACTCA
NM_203290.2       GACCAGGACCGCTTCGAGAAGAATTTCCGTGTGGATGTAGTACACATGGATGAAAACTCA
                  ************************************************************

HsCD00352167      CTGGAGTTTGACATGGTGGGAATTGACGCAGCCATTGCCAATGCTTTTCGACGAATTCTG
NM_203290.2       CTGGAGTTTGACATGGTGGGAATTGACGCAGCCATTGCCAATGCTTTTCGACGAATTCTG
                  ************************************************************

HsCD00352167      CTAGCTGAGGTGCCAACTATGGCTGTGGAGAAGGTCCTGGTGTACAATAATACATCCATT
NM_203290.2       CTAGCTGAGGTGCCAACTATGGCTGTGGAGAAGGTCCTGGTGTACAATAATACATCCATT
                  ************************************************************

HsCD00352167      GTTCAGGATGAGATTCTTGCTCACCGTCTGGGGCTCATTCCCATTCATGCTGATCCCCGT
NM_203290.2       GTTCAGGATGAGATTCTTGCTCACCGTCTGGGGCTCATTCCCATTCATGCTGATCCCCGT
                  ************************************************************

HsCD00352167      CTTTTTGAGTATCGGAACCAAGGAGATGAAGAAGGCACAGAGATAGATACTCTACAGTTT
NM_203290.2       CTTTTTGAGTATCGGAACCAAGGAGATGAAGAAGGCACAGAGATAGATACTCTACAGTTT
                  ************************************************************

HsCD00352167      CGTCTCCAGGTCAGATGCACTCGGAACCCCCATGCTGCTAAAGATTCCTCTGACCCCAAC
NM_203290.2       CGTCTCCAGGTCAGATGCACTCGGAACCCCCATGCTGCTAAAGATTCCTCTGACCCCAAC
                  ************************************************************

HsCD00352167      GAACTGTACGTGAACCACAAAGTGTATACCAGGCATATGACATGGATCCCCCTGGGGAAC
NM_203290.2       GAACTGTACGTGAACCACAAAGTGTATACCAGGCATATGACATGGATCCCCCTGGGGAAC
                  ************************************************************

HsCD00352167      CAGGCTGATCTCTTTCCAGAGGGCACTATCCGACCAGTGCATGATGATATCCTCATCGCT
NM_203290.2       CAGGCTGATCTCTTTCCAGAGGGCACTATCCGACCAGTGCATGATGATATCCTCATCGCT
                  ************************************************************

HsCD00352167      CAGCTGCGGCCTGGCCAAGAAATTGACCTGCTCATGCACTGTGTCAAGGGCATTGGCAAA
NM_203290.2       CAGCTGCGGCCTGGCCAAGAAATTGACCTGCTCATGCACTGTGTCAAGGGCATTGGCAAA
                  ************************************************************

HsCD00352167      GATCATGCCAAGTTTTCACCAGTGGCAACAGCCAGTTACAGGCTCCTGCCAGACATCACC
NM_203290.2       GATCATGCCAAGTTTTCACCAGTGGCAACAGCCAGTTACAGGCTCCTGCCAGACATCACC
                  ************************************************************

HsCD00352167      CTGCTTGAGCCCGTGGAAGGGGAGGCAGCTGAGGAGTTGAGCAGGTGCTTCTCACCTGGT
NM_203290.2       CTGCTTGAGCCCGTGGAAGGGGAGGCAGCTGAGGAGTTGAGCAGGTGCTTCTCACCTGGT
                  ************************************************************

HsCD00352167      GTTATTGAGGTGCAGGAAGTCCAAGGTAAAAAGGTGGCCAGAGTTGCCAACCCCCGGCTG
NM_203290.2       GTTATTGAGGTGCAGGAAGTCCAAGGTAAAAAGGTGGCCAGAGTTGCCAACCCCCGGCTG
                  ************************************************************

HsCD00352167      GATACCTTCAGCAGAGAAATCTTCCGGAATGAGAAGCTAAAGAAGGTTGTGAGGCTTGCC
NM_203290.2       GATACCTTCAGCAGAGAAATCTTCCGGAATGAGAAGCTAAAGAAGGTTGTGAGGCTTGCC
                  ************************************************************

HsCD00352167      CGGGTTCGAGATCATTATATCTTCTCTGTTGAGTCAACGGGGGTGTTGCCACCAGATGTG
NM_203290.2       CGGGTTCGAGATCATTATATCTTCTCTGTTGAGTCAACGGGGGTGTTGCCACCAGATGTG
                  ************************************************************

HsCD00352167      CTGGTGAGTGAAGCCATCAAAGTACTGATGGGGAAGTGCCGGCGCTTCTTGGATGAACTA
NM_203290.2       CTGGTGAGTGAAGCCATCAAAGTACTGATGGGGAAGTGCCGGCGCTTCTTGGATGAACTA
                  ************************************************************

HsCD00352167      GATGCGGTTCAGATGGAC---
NM_203290.2       GATGCGGTTCAGATGGACTGA
                  ******************   

Pathways

Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Epigenetic regulation of gene expression
Reactome : Gene Expression
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : RNA Polymerase I Chain Elongation
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Promoter Escape
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I Transcription Initiation
Reactome : RNA Polymerase I Transcription Termination
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : RNA Polymerase III Abortive And Retractive Initiation
Reactome : RNA Polymerase III Chain Elongation
Reactome : RNA Polymerase III Transcription
Reactome : RNA Polymerase III Transcription Initiation
Reactome : RNA Polymerase III Transcription Initiation From Type 1 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 2 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 3 Promoter
Reactome : RNA Polymerase III Transcription Termination
Reactome : Transcription

Protein

SMART domain : RPOLD : RNA polymerases D
UniProt : O15160
HPRD : 09661

Clone

Cloning Information : 564774

Organism


TAX_ID : 9606
Species Specific ID: 9533

Genome

Chromosome : 6
Map Location : 6p21.1
Ensembl : ENSG00000171453

Reagents

Labome : POLR1C-antibody