DNASU Plasmid Repository • 480.965.5697 | Email

CDA (Homo sapiens) in pDONR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDA
Gene Name:  cytidine deaminase
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100072011)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00353035

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 438nts         Open reading frame : 1 to 438
Reference Sequence Alignment

ATGGCCCAGAAGCGTCCTGCCTGCACCCTGAAGCCTGAGTGTGTCCAGCAGCTGCTGGTT
TGCTCCCAGGAGGCCAAGCAGTCAGCCTACTGCCCCTACAGTCACTTTCCTGTGGGGGCT
GCCCTGCTCACCCAGGAGGGGAGAATCTTCAAAGGGTGCAACATAGAAAATGCCTGCTAC
CCGCTGGGCATCTGTGCTGAACGGACCGCTATCCAGAAGGCCGTCTCAGAAGGGTACAAG
GATTTCAGGGCAATTGCTATCGCCAGTGACATGCAAGATGATTTTATCTCTCCATGTGGG
GCCTGCAGGCAAGTCATGAGAGAGTTTGGCACCAACTGGCCCGTGTACATGACCAAGCCG
GATGGTACGTATATTGTCATGACGGTCCAGGAGCTGCTGCCCTCCTCCTTTGGGCCTGAG
GACCTGCAGAAGACTCAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR223

pDONR223 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Recombinational donor/master vector; spectinomycin resistance; recombinational cloning.
Comments: pDONR223 contains several improvements over the original Donor vector pDONR201. In pDONR223, the universal Forward (Fwd) and Reverse (Rev) sequencing primer sites flank the attP1 and attP2 recombination sites, the replication origin has been improved to increase copy number, and the selectable marker is spectinomycin resistance (instead of kanamycin resistance in pDONR201), which permits the use of either ampicillin or kanamycin resistance markers in Destination vectors.
Size (bp): 5005
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 bacterial origin 4339 4958
death cassette ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1200 1409
primer M13 forward M13 forward sequencing primer 536 553
primer M13 reverse M13 reverse sequencing primer 3020 3040
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only 569 652
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only 2896 2983
selectable marker SpectR spectinomycin resistance gene 3471 4262
trxn termination sequence rrnB rrnB T1 and T2 terminator 268 470

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDA
Symbol Nomenclature : CDA
SYNONYM : CDD
Designation : cytidine aminohydrolase|cytosine nucleoside deaminase|small cytidine deaminase
Full Nomenclature : cytidine deaminase
GENEID : 978
GenBank Accession : 565642
HGNC : 1712
MIM : 123920
Vega : OTTHUMG00000002845
Target GenBank: HQ448573

 

Reference Sequence Alignment

  

HsCD00353035      ATGGCCCAGAAGCGTCCTGCCTGCACCCTGAAGCCTGAGTGTGTCCAGCAGCTGCTGGTT
NM_001785.2       ATGGCCCAGAAGCGTCCTGCCTGCACCCTGAAGCCTGAGTGTGTCCAGCAGCTGCTGGTT
                  ************************************************************

HsCD00353035      TGCTCCCAGGAGGCCAAGCAGTCAGCCTACTGCCCCTACAGTCACTTTCCTGTGGGGGCT
NM_001785.2       TGCTCCCAGGAGGCCAAGAAGTCAGCCTACTGCCCCTACAGTCACTTTCCTGTGGGGGCT
                  ******************.*****************************************

HsCD00353035      GCCCTGCTCACCCAGGAGGGGAGAATCTTCAAAGGGTGCAACATAGAAAATGCCTGCTAC
NM_001785.2       GCCCTGCTCACCCAGGAGGGGAGAATCTTCAAAGGGTGCAACATAGAAAATGCCTGCTAC
                  ************************************************************

HsCD00353035      CCGCTGGGCATCTGTGCTGAACGGACCGCTATCCAGAAGGCCGTCTCAGAAGGGTACAAG
NM_001785.2       CCGCTGGGCATCTGTGCTGAACGGACCGCTATCCAGAAGGCCGTCTCAGAAGGGTACAAG
                  ************************************************************

HsCD00353035      GATTTCAGGGCAATTGCTATCGCCAGTGACATGCAAGATGATTTTATCTCTCCATGTGGG
NM_001785.2       GATTTCAGGGCAATTGCTATCGCCAGTGACATGCAAGATGATTTTATCTCTCCATGTGGG
                  ************************************************************

HsCD00353035      GCCTGCAGGCAAGTCATGAGAGAGTTTGGCACCAACTGGCCCGTGTACATGACCAAGCCG
NM_001785.2       GCCTGCAGGCAAGTCATGAGAGAGTTTGGCACCAACTGGCCCGTGTACATGACCAAGCCG
                  ************************************************************

HsCD00353035      GATGGTACGTATATTGTCATGACGGTCCAGGAGCTGCTGCCCTCCTCCTTTGGGCCTGAG
NM_001785.2       GATGGTACGTATATTGTCATGACGGTCCAGGAGCTGCTGCCCTCCTCCTTTGGGCCTGAG
                  ************************************************************

HsCD00353035      GACCTGCAGAAGACTCAG---
NM_001785.2       GACCTGCAGAAGACCCAGTGA
                  ************** ***   

Pathways

Panther : Pyrimidine Metabolism
Panther : Salvage pyrimidine deoxyribonucleotides
Panther : Salvage pyrimidine ribonucleotides
Reactome : Metabolism
Reactome : Metabolism of nucleotides
Reactome : Pyrimidine metabolism
Reactome : Pyrimidine salvage reactions
WikiPathway : Fluoropyrimidine Activity

Protein

UniProt : P32320
HPRD : 11744

Clone

Cloning Information : 565642

Organism


TAX_ID : 9606
Species Specific ID: 978

Genome

Chromosome : 1
Map Location : 1p36.2-p35
Ensembl : ENSG00000158825

Reagents

Labome : CDA-antibody