DNASU Plasmid Repository • 480.965.5697 | Email

CHRNB3 (Homo sapiens) in pDONR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CHRNB3
Gene Name:  cholinergic receptor, nicotinic, beta 3 (neuronal)
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100070766)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00353147

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1374nts         Open reading frame : 1 to 1374
Reference Sequence Alignment

ATGCTCCCAGATTTTATGCTGGTTCTCATCGTCCTTGGCATCCCTTCCTCAGCCACCACA
GGTTTCAACTCAATCGCCGAAAATGAAGATGCCCTCCTCAGACATTTGTTCCAAGGTTAT
CAGAAATGGGTCCGCCCTGTATTACATTCTAATGACACCATAAAAGTATATTTTGGATTG
AAAATATCCCAGCTTGTAGATGTGGATGAAAAGAATCAGCTGATGACAACCAATGTGTGG
CTCAAACAGGAATGGACAGACCACAAGTTACGCTGGAATCCTGATGATTATGGTGGGATC
CATTCCATTAAAGTTCCATCAGAATCTCTGTGGCTTCCTGACATAGTTCTCTTTGAAAAT
GCTGACGGCCGCTTCGAAGGCTCCCTGATGACCAAGGTCATCGTGAAATCAAACGGAACT
GTTGTCTGGACCCCTCCCGCCAGCTACAAAAGCTCCTGCACCATGGACGTCACGTTTTTC
CCGTTCGACCGACAGAACTGCTCCATGAAGTTTGGATCCTGGACTTATGATGGCACCATG
GTTGACCTCATTTTGATCAATGAAAATGTCGACAGAAAAGACTTCTTCGATAACGGAGAA
TGGGAAATACTGAATGCAAAGGGGATGAAGGGGAACAGAAGGGACGGCGTGTACTCCTAT
CCCTTTATCACGTATTCCTTCGTCCTGAGACGCCTGCCTTTATTCTATACCCTCTTTCTC
ATCATCCCCTGCCTGGGGCTGTCTTTCCTAACAGTTCTTGTGTTCTATTTACCTTCGGAT
GAAGGAGAAAAACTTTCATTATCCACATCGGTCTTGGTTTCTCTGACAGTTTTCCTTTTA
GTGATTGAAGAAATCATCCCATCGTCTTCCAAAGTCATTCCTCTCATTGGAGAGTACCTG
CTGTTCATCATGATTTTTGTGACCCTGTCCATCATTGTTACCGTGTTTGTCATTAACGTT
CACCACAGATCTTCTTCCACGTACCACCCCATGGCCCCCTGGGTTAAGAGGCTCTTTCTG
CAGAAACTTCCAAAATTACTTTGCATGAAAGATCATGTGGATCGCTACTCATCCCCAGAG
AAAGAGGAGAGTCAACCAGTAGTGAAAGGCAAAGTCCTCGAAAAAAAGAAACAGAAACAG
CTTAGTGATGGAGAAAAAGTTCTAGTTGCTTTTTTGGAAAAAGCTGCTGATTCCATTAGA
TACATTTCCAGACATGTGAAGAAAGAACATTTTATCAGCCAGGTAGTACAAGACTGGAAA
TTTGTAGCTCAAGTTCTTGACCGAATCTTCCTGTGGCTCTTTCTGATAGTGTCAGTAACA
GGCTCGGTTCTGATTTTTACCCCTGCTTTGAAGATGTGGCTACATAGTTACCAT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR223

pDONR223 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Recombinational donor/master vector; spectinomycin resistance; recombinational cloning.
Comments: pDONR223 contains several improvements over the original Donor vector pDONR201. In pDONR223, the universal Forward (Fwd) and Reverse (Rev) sequencing primer sites flank the attP1 and attP2 recombination sites, the replication origin has been improved to increase copy number, and the selectable marker is spectinomycin resistance (instead of kanamycin resistance in pDONR201), which permits the use of either ampicillin or kanamycin resistance markers in Destination vectors.
Size (bp): 5005
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 bacterial origin 4339 4958
death cassette ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1200 1409
primer M13 forward M13 forward sequencing primer 536 553
primer M13 reverse M13 reverse sequencing primer 3020 3040
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only 569 652
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only 2896 2983
selectable marker SpectR spectinomycin resistance gene 3471 4262
trxn termination sequence rrnB rrnB T1 and T2 terminator 268 470

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CHRNB3
Symbol Nomenclature : CHRNB3
Designation : acetylcholine receptor, neuronal nicotinic, beta-3 subunit|acetylcholine receptor, nicotinic, beta 3 (neuronal)|cholinergic receptor, nicotinic, beta polypeptide 3|neuronal acetylcholine receptor subunit beta-3
Full Nomenclature : cholinergic receptor, nicotinic, beta 3 (neuronal)
GENEID : 1142
GenBank Accession : 565754
HGNC : 1963
MIM : 118508
Vega : OTTHUMG00000165262
Target GenBank: HQ447438

 

Reference Sequence Alignment

  

HsCD00353147      ATGCTCCCAGATTTTATGCTGGTTCTCATCGTCCTTGGCATCCCTTCCTCAGCCACCACA
NM_000749.3       ATGCTCCCAGATTTTATGCTGGTTCTCATCGTCCTTGGCATCCCTTCCTCAGCCACCACA
                  ************************************************************

HsCD00353147      GGTTTCAACTCAATCGCCGAAAATGAAGATGCCCTCCTCAGACATTTGTTCCAAGGTTAT
NM_000749.3       GGTTTCAACTCAATCGCCGAAAATGAAGATGCCCTCCTCAGACATTTGTTCCAAGGTTAT
                  ************************************************************

HsCD00353147      CAGAAATGGGTCCGCCCTGTATTACATTCTAATGACACCATAAAAGTATATTTTGGATTG
NM_000749.3       CAGAAATGGGTCCGCCCTGTATTACATTCTAATGACACCATAAAAGTATATTTTGGATTG
                  ************************************************************

HsCD00353147      AAAATATCCCAGCTTGTAGATGTGGATGAAAAGAATCAGCTGATGACAACCAATGTGTGG
NM_000749.3       AAAATATCCCAGCTTGTAGATGTGGATGAAAAGAATCAGCTGATGACAACCAATGTGTGG
                  ************************************************************

HsCD00353147      CTCAAACAGGAATGGACAGACCACAAGTTACGCTGGAATCCTGATGATTATGGTGGGATC
NM_000749.3       CTCAAACAGGAATGGACAGACCACAAGTTACGCTGGAATCCTGATGATTATGGTGGGATC
                  ************************************************************

HsCD00353147      CATTCCATTAAAGTTCCATCAGAATCTCTGTGGCTTCCTGACATAGTTCTCTTTGAAAAT
NM_000749.3       CATTCCATTAAAGTTCCATCAGAATCTCTGTGGCTTCCTGACATAGTTCTCTTTGAAAAT
                  ************************************************************

HsCD00353147      GCTGACGGCCGCTTCGAAGGCTCCCTGATGACCAAGGTCATCGTGAAATCAAACGGAACT
NM_000749.3       GCTGACGGCCGCTTCGAAGGCTCCCTGATGACCAAGGTCATCGTGAAATCAAACGGAACT
                  ************************************************************

HsCD00353147      GTTGTCTGGACCCCTCCCGCCAGCTACAAAAGCTCCTGCACCATGGACGTCACGTTTTTC
NM_000749.3       GTTGTCTGGACCCCTCCCGCCAGCTACAAAAGCTCCTGCACCATGGACGTCACGTTTTTC
                  ************************************************************

HsCD00353147      CCGTTCGACCGACAGAACTGCTCCATGAAGTTTGGATCCTGGACTTATGATGGCACCATG
NM_000749.3       CCGTTCGACCGACAGAACTGCTCCATGAAGTTTGGATCCTGGACTTATGATGGCACCATG
                  ************************************************************

HsCD00353147      GTTGACCTCATTTTGATCAATGAAAATGTCGACAGAAAAGACTTCTTCGATAACGGAGAA
NM_000749.3       GTTGACCTCATTTTGATCAATGAAAATGTCGACAGAAAAGACTTCTTCGATAACGGAGAA
                  ************************************************************

HsCD00353147      TGGGAAATACTGAATGCAAAGGGGATGAAGGGGAACAGAAGGGACGGCGTGTACTCCTAT
NM_000749.3       TGGGAAATACTGAACGCAAAGGGGATGAAGGGGAACAGAAGGGACGGCGTGTACTCCTAT
                  ************** *********************************************

HsCD00353147      CCCTTTATCACGTATTCCTTCGTCCTGAGACGCCTGCCTTTATTCTATACCCTCTTTCTC
NM_000749.3       CCCTTTATCACGTATTCCTTCGTCCTGAGACGCCTGCCTTTATTCTATACCCTCTTTCTC
                  ************************************************************

HsCD00353147      ATCATCCCCTGCCTGGGGCTGTCTTTCCTAACAGTTCTTGTGTTCTATTTACCTTCGGAT
NM_000749.3       ATCATCCCCTGCCTGGGGCTGTCTTTCCTAACAGTTCTTGTGTTCTATTTACCTTCGGAT
                  ************************************************************

HsCD00353147      GAAGGAGAAAAACTTTCATTATCCACATCGGTCTTGGTTTCTCTGACAGTTTTCCTTTTA
NM_000749.3       GAAGGAGAAAAACTTTCATTATCCACATCGGTCTTGGTTTCTCTGACAGTTTTCCTTTTA
                  ************************************************************

HsCD00353147      GTGATTGAAGAAATCATCCCATCGTCTTCCAAAGTCATTCCTCTCATTGGAGAGTACCTG
NM_000749.3       GTGATTGAAGAAATCATCCCATCGTCTTCCAAAGTCATTCCTCTCATTGGAGAGTACCTG
                  ************************************************************

HsCD00353147      CTGTTCATCATGATTTTTGTGACCCTGTCCATCATTGTTACCGTGTTTGTCATTAACGTT
NM_000749.3       CTGTTCATCATGATTTTTGTGACCCTGTCCATCATTGTTACCGTGTTTGTCATTAACGTT
                  ************************************************************

HsCD00353147      CACCACAGATCTTCTTCCACGTACCACCCCATGGCCCCCTGGGTTAAGAGGCTCTTTCTG
NM_000749.3       CACCACAGATCTTCTTCCACGTACCACCCCATGGCCCCCTGGGTTAAGAGGCTCTTTCTG
                  ************************************************************

HsCD00353147      CAGAAACTTCCAAAATTACTTTGCATGAAAGATCATGTGGATCGCTACTCATCCCCAGAG
NM_000749.3       CAGAAACTTCCAAAATTACTTTGCATGAAAGATCATGTGGATCGCTACTCATCCCCAGAG
                  ************************************************************

HsCD00353147      AAAGAGGAGAGTCAACCAGTAGTGAAAGGCAAAGTCCTCGAAAAAAAGAAACAGAAACAG
NM_000749.3       AAAGAGGAGAGTCAACCAGTAGTGAAAGGCAAAGTCCTCGAAAAAAAGAAACAGAAACAG
                  ************************************************************

HsCD00353147      CTTAGTGATGGAGAAAAAGTTCTAGTTGCTTTTTTGGAAAAAGCTGCTGATTCCATTAGA
NM_000749.3       CTTAGTGATGGAGAAAAAGTTCTAGTTGCTTTTTTGGAAAAAGCTGCTGATTCCATTAGA
                  ************************************************************

HsCD00353147      TACATTTCCAGACATGTGAAGAAAGAACATTTTATCAGCCAGGTAGTACAAGACTGGAAA
NM_000749.3       TACATTTCGAGACATGTGAAGAAAGAACATTTTATCAGCCAGGTAGTACAAGACTGGAAA
                  ******** ***************************************************

HsCD00353147      TTTGTAGCTCAAGTTCTTGACCGAATCTTCCTGTGGCTCTTTCTGATAGTGTCAGTAACA
NM_000749.3       TTTGTAGCTCAAGTTCTTGACCGAATCTTCCTGTGGCTCTTTCTGATAGTGTCAGTAACA
                  ************************************************************

HsCD00353147      GGCTCGGTTCTGATTTTTACCCCTGCTTTGAAGATGTGGCTACATAGTTACCAT---
NM_000749.3       GGCTCGGTTCTGATTTTTACCCCTGCTTTGAAGATGTGGCTACATAGTTACCATTAG
                  ******************************************************   

Pathways

Panther : Nicotine pharmacodynamics pathway
Panther : Nicotinic acetylcholine receptor signaling pathway
Reactome : Acetylcholine Binding And Downstream Events
Reactome : Activation of Nicotinic Acetylcholine Receptors
Reactome : Highly calcium permeable nicotinic acetylcholine receptors
Reactome : Highly calcium permeable postsynaptic nicotinic acetylcholine receptors
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Postsynaptic nicotinic acetylcholine receptors
Reactome : Presynaptic nicotinic acetylcholine receptors
Reactome : Transmission across Chemical Synapses

Protein

UniProt : Q05901
HPRD : 00336

Clone

Cloning Information : 565754

Organism


TAX_ID : 9606
Species Specific ID: 1142

Genome

Chromosome : 8
Map Location : 8p11.2
Ensembl : ENSG00000147432

Reagents

Labome : CHRNB3-antibody