DNASU Plasmid Repository • 480.965.5697 | Email

ZRSR2 (Homo sapiens) in pDONR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ZRSR2
Gene Name:  zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100073101)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00353688

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1446nts         Open reading frame : 1 to 1446

ATGGCTGCGCCCGAGAAGATGACGTTTCCCGAGAAACCAAGCCACAAAAAGTACAGGGCC
GCCCTGAAGAAGGAGAAACGAAAGAAACGTCGGCAGGAACTTGCTCGACTGAGAGACTCA
GGACTCTCACAGAAGGAGGAAGAGGAGGACACTTTTATTGAAGAACAACAACTAGAAGAA
GAGAAGCTATTGGAAAGAGAGAGGCAAAGATTACATGAGGAGTGGTTGCTAAGAGAGCAG
AAGGCACAAGAAGAATTCAGAATAAAGAAGGAAAAGGAAGAGGCGGCTAAAAAACGGCAA
GAAGAACAAGAGAGAAAGTTAAAGGAACAATGGGAAGAACAGCAGAGGAAAGAGAGAGAA
GAGGAGGAGCAGAAACGACAGGAGAAGAAAGAAAAAGAGGAAGCTTTGCAGAAGATGCTG
GATCAGGCTGAAAATGAGTTGGAAAATGGTACCACATGGCAAAACCCAGAACCACCCGTG
GATTTCAGAGTAATGGAGAAGGATCGAGCTAATTGTCCCTTCTACAGTAAAACAGGAGCT
TGCAGATTTGGAGATAGATGTTCACGTAAACATAATTTCCCAACATCCAGTCCTACCCTT
CTTATTAAGAGCATGTTTACGACGTTTGGAATGGAGCAGTGCAGGAGGGATGACTATGAC
CCTGACGCAAGCCTGGAGTACAGCGAGGAAGAAACCTACCAACAGTTCCTAGACTTCTAT
GAGGATGTGTTGCCCGAGTTCAAGAACGTGGGGAAAGTGATTCAGTTCAAGGTCAGCTGC
AATTTGGAACCTCACCTGAGGGGCAATGTATATGTTCAGTACCAGTCGGAAGAAGAATGC
CAAGCAGCCCTTTCTCTGTTTAACGGACGATGGTATGCAGGACGACAGCTGCAGTGTGAA
TTCTGCCCCGTGACCCGGTGGAAAATGGCGATTTGTGGTTTATTTGAAATACAACAATGT
CCAAGAGGAAAGCACTGCAACTTTCTTCATGTGTTCAGAAATCCCAACAATGAATTCTGG
GAAGCTAATAGAGACATCTACTTGTCTCCAGATCGGACTGGCTCCTCCTTTGGGAAGAAC
TCCGAAAGGAGGGAGAGGATGGGCCACCACGACGACTACTACAGCAGGCTGCGGGGAAGG
AGAAACCCTAGTCCAGACCACTCCTACAAAAGAAATGGGGAATCCGAGAGGAAAAGTAGT
CGTCACAGGGGGAAGAAATCTCACAAACGCACATCAAAGAGTCGGGAGAGGCACAATTCA
CGAAGCAGAGGAAGAAATAGGGACCGCAGCAGGGACCGCAGCCGGGGCCGGGGCAGCCGG
AGCCGGAGCCGGAGCCGGAGCCGCAGGAGCCGCCGCAGCCGGAGCCAAAGTTCCTCTAGG
TCCCGAAGTCGTGGCAGGAGGAGGTCGGGTAATAGAGACAGAACTGTTCAGAGTCCCAAA
TCCAAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR223

pDONR223 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Recombinational donor/master vector; spectinomycin resistance; recombinational cloning.
Comments: pDONR223 contains several improvements over the original Donor vector pDONR201. In pDONR223, the universal Forward (Fwd) and Reverse (Rev) sequencing primer sites flank the attP1 and attP2 recombination sites, the replication origin has been improved to increase copy number, and the selectable marker is spectinomycin resistance (instead of kanamycin resistance in pDONR201), which permits the use of either ampicillin or kanamycin resistance markers in Destination vectors.
Size (bp): 5005
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 bacterial origin 4339 4958
death cassette ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1200 1409
primer M13 forward M13 forward sequencing primer 536 553
primer M13 reverse M13 reverse sequencing primer 3020 3040
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only 569 652
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only 2896 2983
selectable marker SpectR spectinomycin resistance gene 3471 4262
trxn termination sequence rrnB rrnB T1 and T2 terminator 268 470

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ZRSR2
Symbol Nomenclature : ZRSR2
SYNONYM : U2AF1-RS2; U2AF1L2; U2AF1RS2; URP
Designation : U2 small nuclear ribonucleoprotein auxiliary factor 35 kDa subunit-related protein 2|U2 small nuclear ribonucleoprotein auxiliary factor, small subunit 2|U2(RNU2) small nuclear RNA auxiliary factor 1-like 2|U2AF35-related protein|renal carcinoma antigen NY-REN-20
Full Nomenclature : zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
GENEID : 8233
GenBank Accession : 571690
HGNC : 23019
MIM : 300028
Vega : OTTHUMG00000021184
Target GenBank: HQ258575

 

Pathways

Panther : mRNA splicing

Protein

SMART domain : RRM_1 : RNA recognition motif
SMART domain : ZnF_C3H1 : zinc finger
SMART domain : RRM : RNA recognition motif
UniProt : Q15696
HPRD : 02068

Clone

Cloning Information : 571690

Organism


TAX_ID : 9606
Species Specific ID: 8233

Genome

Chromosome : X
Map Location : Xp22.1
Ensembl : ENSG00000169249

Reagents

Labome : ZRSR2-antibody