DNASU Plasmid Repository • 480.965.5697 | Email

RPA1 (Homo sapiens) in pDONR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RPA1
Gene Name:  replication protein A1, 70kDa
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100073067)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00353697

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1848nts         Open reading frame : 1 to 1848
Reference Sequence Alignment

ATGGTCGGCCAACTGAGCGAGGGGGCCATTGCGGCCATCATGCAGAAGGGGGATACAAAC
ATAAAGCCCATCCTCCAAGTCATCAACATCCGTCCCATTACTACGGGGAATAGTCCGCCG
CGTTATCGACTGCTCATGAGTGATGGATTGAACACTCTATCCTCTTTCATGTTGGCGACA
CAGTTGAACCCTCTCGTGGAGGAAGAACAATTGTCCAGCAACTGTGTATGCCAGATTCAC
AGATTTATTGTGAACACTCTGAAAGACGGAAGGAGAGTAGTTATCTTGATGGAATTAGAA
GTTTTGAAGTCAGCTGAAGCAGTTGGAGTGAAGATTGGCAATCCAGTGCCCTATAATGAA
GGACTCGGGCAGCCGCAAGTAGCTCCTCCAGCGCCAGCAGCCAGCCCAGCAGCAAGCAGC
AGGCCCCAGCCGCAGAATGGAAGCTCGGGAATGGGTTCTACTGTTTCTAAGGCTTATGGT
GCTTCAAAGACATTTGGAAAAGCTGCAGGTCCCAGCCTGTCACACACTTCTGGGGGAACA
CAGTCCAAAGTGGTGCCCATTGCCAGCCTCACTCCTTACCAGTCCAAGTGGACCATTTGT
GCTCGTGTTACCAACAAAAGTCAGATCCGTACCTGGAGCAACTCCCGAGGGGAAGGGAAG
CTTTTCTCCCTAGAACTGGTTGACGAAAGTGGTGAAATCCGAGCTACAGCTTTCAATGAG
CAAGTGGACAAGTTCTTTCCTCTTATTGAAGTGAACAAGGTGTATTATTTCTCGAAAGGC
ACCCTGAAGATTGCTAACAAGCAGTTCACAGCTGTTAAAAATGACTACGAGATGACCTTC
AATAACGAGACTTCCGTCATGCCCTGTGAGGACGACCATCATTTACCTACGGTTCAGTTT
GATTTCACGGGGATTGATGACCTCGAGAACAAGTCGAAAGACTCACTTGTAGACATCATC
GGGATCTGCAAGAGCTATGAAGACGCCACTAAAATCACAGTGAGGTCTAACAACAGAGAA
GTTGCCAAGAGGAATATCTACTTGATGGACACATCTGGGAAGGTGGTGACTGCTACACTG
TGGGGGGAAGATGCTGATAAATTTGATGGTTCTAGACAGCCCGTGTTGGCTATCAAAGGA
GCCCGAGTCTCTGATTTCGGTGGACGGAGCCTCTCCGTGCTGTCTTCAAGCACTATCATT
GCGAATCCTGACATCCCAGAGGCCTATAAGCTTCGTGGATGGTTTGACGCAGAAGGACAA
GCCTTAGATGGTGTTTCCATCTCTGATCTAAAGAGCGGCGGAGTCGGAGGGAGTAACACC
AACTGGAAAACCTTGTATGAGGTCAAATCCGAGAACCTGGGCCAAGGCGACAAGCCGGAC
TACTTTAGTTCTGTGGCCACAGTGGTGTATCTTCGCAAAGAGAACTGCATGTACCAAGCC
TGCCCGACTCAGGACTGCAATAAGAAAGTGATTGATCAACAGAATGGATTGTACCGCTGT
GAGAAGTGCGACACCGAATTTCCCAATTTCAAGTACCGCATGATCCTGTCAGTAAATATT
GCAGATTTTCAAGAGAATCAGTGGGTGACTTGTTTCCAGGAGTCTGCTGAAGCTATCCTT
GGACAAAATGCTGCTTATCTTGGGGAATTAAAAGACAAGAATGAACAGGCATTTGAAGAA
GTTTTCCAGAATGCCAACTTCCGATCTTTCATATTCAGAGTCAGGGTCAAAGTGGAGACC
TACAACGACGAGTCTCGAATTAAGGCCACTGTGATGGACGTGAAGCCCGTGGACTACAGA
GAGTATGGCCGAAGGCTGGTCATGAGCATCAGGAGAAGTGCATTGATG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR223

pDONR223 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Recombinational donor/master vector; spectinomycin resistance; recombinational cloning.
Comments: pDONR223 contains several improvements over the original Donor vector pDONR201. In pDONR223, the universal Forward (Fwd) and Reverse (Rev) sequencing primer sites flank the attP1 and attP2 recombination sites, the replication origin has been improved to increase copy number, and the selectable marker is spectinomycin resistance (instead of kanamycin resistance in pDONR201), which permits the use of either ampicillin or kanamycin resistance markers in Destination vectors.
Size (bp): 5005
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 bacterial origin 4339 4958
death cassette ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1200 1409
primer M13 forward M13 forward sequencing primer 536 553
primer M13 reverse M13 reverse sequencing primer 3020 3040
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only 569 652
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only 2896 2983
selectable marker SpectR spectinomycin resistance gene 3471 4262
trxn termination sequence rrnB rrnB T1 and T2 terminator 268 470

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RPA1
Symbol Nomenclature : RPA1
SYNONYM : HSSB; MST075; REPA1; RF-A; RP-A; RPA70
Designation : MSTP075|RF-A protein 1|RP-A p70|replication factor A protein 1|replication protein A 70 kDa DNA-binding subunit|single-stranded DNA-binding protein
Full Nomenclature : replication protein A1, 70kDa
GENEID : 6117
GenBank Accession : 571699
HGNC : 10289
MIM : 179835
Vega : OTTHUMG00000090579
Target GenBank: HQ258560

 

Reference Sequence Alignment

  

HsCD00353697      ATGGTCGGCCAACTGAGCGAGGGGGCCATTGCGGCCATCATGCAGAAGGGGGATACAAAC
NM_002945.3       ATGGTCGGCCAACTGAGCGAGGGGGCCATTGCGGCCATCATGCAGAAGGGGGATACAAAC
                  ************************************************************

HsCD00353697      ATAAAGCCCATCCTCCAAGTCATCAACATCCGTCCCATTACTACGGGGAATAGTCCGCCG
NM_002945.3       ATAAAGCCCATCCTCCAAGTCATCAACATCCGTCCCATTACTACGGGGAATAGTCCGCCG
                  ************************************************************

HsCD00353697      CGTTATCGACTGCTCATGAGTGATGGATTGAACACTCTATCCTCTTTCATGTTGGCGACA
NM_002945.3       CGTTATCGACTGCTCATGAGTGATGGATTGAACACTCTATCCTCTTTCATGTTGGCGACA
                  ************************************************************

HsCD00353697      CAGTTGAACCCTCTCGTGGAGGAAGAACAATTGTCCAGCAACTGTGTATGCCAGATTCAC
NM_002945.3       CAGTTGAACCCTCTCGTGGAGGAAGAACAATTGTCCAGCAACTGTGTATGCCAGATTCAC
                  ************************************************************

HsCD00353697      AGATTTATTGTGAACACTCTGAAAGACGGAAGGAGAGTAGTTATCTTGATGGAATTAGAA
NM_002945.3       AGATTTATTGTGAACACTCTGAAAGACGGAAGGAGAGTAGTTATCTTGATGGAATTAGAA
                  ************************************************************

HsCD00353697      GTTTTGAAGTCAGCTGAAGCAGTTGGAGTGAAGATTGGCAATCCAGTGCCCTATAATGAA
NM_002945.3       GTTTTGAAGTCAGCTGAAGCAGTTGGAGTGAAGATTGGCAATCCAGTGCCCTATAATGAA
                  ************************************************************

HsCD00353697      GGACTCGGGCAGCCGCAAGTAGCTCCTCCAGCGCCAGCAGCCAGCCCAGCAGCAAGCAGC
NM_002945.3       GGACTCGGGCAGCCGCAAGTAGCTCCTCCAGCGCCAGCAGCCAGCCCAGCAGCAAGCAGC
                  ************************************************************

HsCD00353697      AGGCCCCAGCCGCAGAATGGAAGCTCGGGAATGGGTTCTACTGTTTCTAAGGCTTATGGT
NM_002945.3       AGGCCCCAGCCGCAGAATGGAAGCTCGGGAATGGGTTCTACTGTTTCTAAGGCTTATGGT
                  ************************************************************

HsCD00353697      GCTTCAAAGACATTTGGAAAAGCTGCAGGTCCCAGCCTGTCACACACTTCTGGGGGAACA
NM_002945.3       GCTTCAAAGACATTTGGAAAAGCTGCAGGTCCCAGCCTGTCACACACTTCTGGGGGAACA
                  ************************************************************

HsCD00353697      CAGTCCAAAGTGGTGCCCATTGCCAGCCTCACTCCTTACCAGTCCAAGTGGACCATTTGT
NM_002945.3       CAGTCCAAAGTGGTGCCCATTGCCAGCCTCACTCCTTACCAGTCCAAGTGGACCATTTGT
                  ************************************************************

HsCD00353697      GCTCGTGTTACCAACAAAAGTCAGATCCGTACCTGGAGCAACTCCCGAGGGGAAGGGAAG
NM_002945.3       GCTCGTGTTACCAACAAAAGTCAGATCCGTACCTGGAGCAACTCCCGAGGGGAAGGGAAG
                  ************************************************************

HsCD00353697      CTTTTCTCCCTAGAACTGGTTGACGAAAGTGGTGAAATCCGAGCTACAGCTTTCAATGAG
NM_002945.3       CTTTTCTCCCTAGAACTGGTTGACGAAAGTGGTGAAATCCGAGCTACAGCTTTCAATGAG
                  ************************************************************

HsCD00353697      CAAGTGGACAAGTTCTTTCCTCTTATTGAAGTGAACAAGGTGTATTATTTCTCGAAAGGC
NM_002945.3       CAAGTGGACAAGTTCTTTCCTCTTATTGAAGTGAACAAGGTGTATTATTTCTCGAAAGGC
                  ************************************************************

HsCD00353697      ACCCTGAAGATTGCTAACAAGCAGTTCACAGCTGTTAAAAATGACTACGAGATGACCTTC
NM_002945.3       ACCCTGAAGATTGCTAACAAGCAGTTCACAGCTGTTAAAAATGACTACGAGATGACCTTC
                  ************************************************************

HsCD00353697      AATAACGAGACTTCCGTCATGCCCTGTGAGGACGACCATCATTTACCTACGGTTCAGTTT
NM_002945.3       AATAACGAGACTTCCGTCATGCCCTGTGAGGACGACCATCATTTACCTACGGTTCAGTTT
                  ************************************************************

HsCD00353697      GATTTCACGGGGATTGATGACCTCGAGAACAAGTCGAAAGACTCACTTGTAGACATCATC
NM_002945.3       GATTTCACGGGGATTGATGACCTCGAGAACAAGTCGAAAGACTCACTTGTAGACATCATC
                  ************************************************************

HsCD00353697      GGGATCTGCAAGAGCTATGAAGACGCCACTAAAATCACAGTGAGGTCTAACAACAGAGAA
NM_002945.3       GGGATCTGCAAGAGCTATGAAGACGCCACTAAAATCACAGTGAGGTCTAACAACAGAGAA
                  ************************************************************

HsCD00353697      GTTGCCAAGAGGAATATCTACTTGATGGACACATCTGGGAAGGTGGTGACTGCTACACTG
NM_002945.3       GTTGCCAAGAGGAATATCTACTTGATGGACACATCCGGGAAGGTGGTGACTGCTACACTG
                  *********************************** ************************

HsCD00353697      TGGGGGGAAGATGCTGATAAATTTGATGGTTCTAGACAGCCCGTGTTGGCTATCAAAGGA
NM_002945.3       TGGGGGGAAGATGCTGATAAATTTGATGGTTCTAGACAGCCCGTGTTGGCTATCAAAGGA
                  ************************************************************

HsCD00353697      GCCCGAGTCTCTGATTTCGGTGGACGGAGCCTCTCCGTGCTGTCTTCAAGCACTATCATT
NM_002945.3       GCCCGAGTCTCTGATTTCGGTGGACGGAGCCTCTCCGTGCTGTCTTCAAGCACTATCATT
                  ************************************************************

HsCD00353697      GCGAATCCTGACATCCCAGAGGCCTATAAGCTTCGTGGATGGTTTGACGCAGAAGGACAA
NM_002945.3       GCGAATCCTGACATCCCAGAGGCCTATAAGCTTCGTGGATGGTTTGACGCAGAAGGACAA
                  ************************************************************

HsCD00353697      GCCTTAGATGGTGTTTCCATCTCTGATCTAAAGAGCGGCGGAGTCGGAGGGAGTAACACC
NM_002945.3       GCCTTAGATGGTGTTTCCATCTCTGATCTAAAGAGCGGCGGAGTCGGAGGGAGTAACACC
                  ************************************************************

HsCD00353697      AACTGGAAAACCTTGTATGAGGTCAAATCCGAGAACCTGGGCCAAGGCGACAAGCCGGAC
NM_002945.3       AACTGGAAAACCTTGTATGAGGTCAAATCCGAGAACCTGGGCCAAGGCGACAAGCCGGAC
                  ************************************************************

HsCD00353697      TACTTTAGTTCTGTGGCCACAGTGGTGTATCTTCGCAAAGAGAACTGCATGTACCAAGCC
NM_002945.3       TACTTTAGTTCTGTGGCCACAGTGGTGTATCTTCGCAAAGAGAACTGCATGTACCAAGCC
                  ************************************************************

HsCD00353697      TGCCCGACTCAGGACTGCAATAAGAAAGTGATTGATCAACAGAATGGATTGTACCGCTGT
NM_002945.3       TGCCCGACTCAGGACTGCAATAAGAAAGTGATTGATCAACAGAATGGATTGTACCGCTGT
                  ************************************************************

HsCD00353697      GAGAAGTGCGACACCGAATTTCCCAATTTCAAGTACCGCATGATCCTGTCAGTAAATATT
NM_002945.3       GAGAAGTGCGACACCGAATTTCCCAATTTCAAGTACCGCATGATCCTGTCAGTAAATATT
                  ************************************************************

HsCD00353697      GCAGATTTTCAAGAGAATCAGTGGGTGACTTGTTTCCAGGAGTCTGCTGAAGCTATCCTT
NM_002945.3       GCAGATTTTCAAGAGAATCAGTGGGTGACTTGTTTCCAGGAGTCTGCTGAAGCTATCCTT
                  ************************************************************

HsCD00353697      GGACAAAATGCTGCTTATCTTGGGGAATTAAAAGACAAGAATGAACAGGCATTTGAAGAA
NM_002945.3       GGACAAAATGCTGCTTATCTTGGGGAATTAAAAGACAAGAATGAACAGGCATTTGAAGAA
                  ************************************************************

HsCD00353697      GTTTTCCAGAATGCCAACTTCCGATCTTTCATATTCAGAGTCAGGGTCAAAGTGGAGACC
NM_002945.3       GTTTTCCAGAATGCCAACTTCCGATCTTTCATATTCAGAGTCAGGGTCAAAGTGGAGACC
                  ************************************************************

HsCD00353697      TACAACGACGAGTCTCGAATTAAGGCCACTGTGATGGACGTGAAGCCCGTGGACTACAGA
NM_002945.3       TACAACGACGAGTCTCGAATTAAGGCCACTGTGATGGACGTGAAGCCCGTGGACTACAGA
                  ************************************************************

HsCD00353697      GAGTATGGCCGAAGGCTGGTCATGAGCATCAGGAGAAGTGCATTGATG---
NM_002945.3       GAGTATGGCCGAAGGCTGGTCATGAGCATCAGGAGAAGTGCATTGATGTGA
                  ************************************************   

Pathways

NCI : ATR signaling pathway
NCI : Fanconi anemia pathway
Reactome : Activation of ATR in response to replication stress
Reactome : Activation of the pre-replicative complex
Reactome : Assembly of the RAD51-ssDNA nucleoprotein complex
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : DNA strand elongation
Reactome : Double-Strand Break Repair
Reactome : Dual incision reaction in GG-NER
Reactome : Extension of Telomeres
Reactome : Formation of incision complex in GG-NER
Reactome : G1/S Transition
Reactome : G2/M Checkpoints
Reactome : Gap-filling DNA repair synthesis and ligation in GG-NER
Reactome : Gap-filling DNA repair synthesis and ligation in TC-NER
Reactome : Global Genomic NER (GG-NER)
Reactome : HSF1 activation
Reactome : Homologous DNA pairing and strand exchange
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Lagging Strand Synthesis
Reactome : M/G1 Transition
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Nucleotide Excision Repair
Reactome : Presynaptic phase of homologous DNA pairing and strand exchange
Reactome : Processing of DNA double-strand break ends
Reactome : Processive synthesis on the C-strand of the telomere
Reactome : Processive synthesis on the lagging strand
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Removal of the Flap Intermediate
Reactome : Removal of the Flap Intermediate from the C-strand
Reactome : Repair synthesis for gap-filling by DNA polymerase in TC-NER
Reactome : Repair synthesis of patch ~27-30 bases long by DNA polymerase
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance
Reactome : Transcription-coupled NER (TC-NER)

Protein

UniProt : P27694
HPRD : 01565

Clone

Cloning Information : 571699

Organism


TAX_ID : 9606
Species Specific ID: 6117

Genome

Chromosome : 17
Map Location : 17p13.3
Ensembl : ENSG00000132383

Reagents

Labome : RPA1-antibody