DNASU Plasmid Repository • 480.965.5697 | Email

UBE2Q1 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  UBE2Q1
Gene Name:  ubiquitin-conjugating enzyme E2Q family member 1
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100069011)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00353937

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1269nts         Open reading frame : 1 to 1269
Reference Sequence Alignment

ATGCAGCAGCCGCAGCCGCAGGGGCAGCAGCAGCCGGGGCCGGGGCAGCAGCTGGGGGGC
CAGGGGGCGGCGCCGGGGGCCGGGGGCGGCCCAGGGGGGGGCCCGGGGCCGGGGCCCTGC
CTGAGGCGAGAGCTGAAGCTGCTCGAGTCCATCTTCCACCGCGGCCACGAGCGCTTCCGC
ATTGCCAGCGCCTGCCTGGACGAGCTGAGCTGCGAGTTCCTGCTGGCTGGGGCCGGAGGG
GCCGGGGCGGGGGCCGCGCCCGGACCGCATCTCCCCCCACGGGGGTCGGTGCCTGGGGAT
CCTGTCCGCATCCACTGCAACATCACGGAGTCATACCCTGCTGTGCCCCCCATCTGGTCG
GTGGAGTCTGATGACCCTAACTTGGCTGCTGTCTTGGAGAGGCTGGTGGACATAAAGAAA
GGGAATACTCTGCTATTGCAGCATCTGAAGAGGATCATCTCCGACCTGTGTAAACTCTAT
AACCTCCCTCAGCATCCAGATGTGGAGATGCTGGATCAACCCTTGCCAGCAGAGCAGTGC
ACACAGGAAGACGTGTCTTCAGAAGATGAAGATGAGGAGATGCCTGAGGACACAGAAGAC
TTAGATCACTATGAAATGAAAGAGGAAGAGCCAGCTGAGGGCAAGAAATCTGAAGATGAT
GGCATTGGAAAAGAAAACTTGGCCATCCTAGAGAAAATTAAAAAGAACCAGAGGCAAGAT
TACTTAAATGGTGCAGTGTCTGGCTCGGTGCAGGCCACTGACCGGCTGATGAAGGAGCTC
AGGGATATATACCGATCACAGAGTTTCAAAGGCGGAAACTATGCAGTCGAACTCGTGAAT
GACAGTCTGTATGATTGGAATGTCAAACTCCTCAAAGTTGACCAGGACAGCGCTTTGCAC
AACGATCTCCAGATCCTCAAAGAGAAAGAAGGAGCCGACTTCATTCTACTTAACTTTTCC
TTTAAAGATAACTTTCCCTTTGACCCACCATTTGTCAGGGTTGTGTCTCCAGTCCTCTCT
GGAGGGTATGTTCTGGGCGGAGGGGCCATCTGCATGGAACTTCTCACCAAACAGGGCTGG
AGCAGTGCCTACTCCATAGAGTCAGTGATCATGCAGATCAGTGCCACACTGGTGAAGGGG
AAAGCACGAGTGCAGTTTGGAGCCAACAAATCTCAATACAGTCTGACAAGAGCACAGCAG
TCCTACAAGTCCTTGGTGCAGATCCACGAAAAAAACGGCTGGTACACACCCCCAAAAGAA
GACGGCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : UBE2Q1
Symbol Nomenclature : UBE2Q1
SYNONYM : GTAP; NICE-5; UBE2Q
Designation : galactosyl transferase-associated protein|protein NICE-5|ubiquitin carrier protein Q1|ubiquitin-conjugating enzyme E2 Q1|ubiquitin-conjugating enzyme E2Q (putative) 1|ubiquitin-protein ligase Q1
Full Nomenclature : ubiquitin-conjugating enzyme E2Q family member 1
GENEID : 55585
Locus Tag : PRO3094
GenBank Accession : 571939
HGNC : 15698
Vega : OTTHUMG00000037265
Target GenBank: BC172317

 

Reference Sequence Alignment

  

HsCD00353937      ATGCAGCAGCCGCAGCCGCAGGGGCAGCAGCAGCCGGGGCCGGGGCAGCAGCTGGGGGGC
NM_017582.6       ATGCAGCAGCCGCAGCCGCAGGGGCAGCAGCAGCCGGGGCCGGGGCAGCAGCTGGGGGGC
                  ************************************************************

HsCD00353937      CAGGGGGCGGCGCCGGGGGCCGGGGGCGGCCCAGGGGGGGGCCCGGGGCCGGGGCCCTGC
NM_017582.6       CAGGGGGCGGCGCCGGGGGCCGGGGGCGGCCCAGGGGGGGGCCCGGGGCCGGGGCCCTGC
                  ************************************************************

HsCD00353937      CTGAGGCGAGAGCTGAAGCTGCTCGAGTCCATCTTCCACCGCGGCCACGAGCGCTTCCGC
NM_017582.6       CTGAGGCGAGAGCTGAAGCTGCTCGAGTCCATCTTCCACCGCGGCCACGAGCGCTTCCGC
                  ************************************************************

HsCD00353937      ATTGCCAGCGCCTGCCTGGACGAGCTGAGCTGCGAGTTCCTGCTGGCTGGGGCCGGAGGG
NM_017582.6       ATTGCCAGCGCCTGCCTGGACGAGCTGAGCTGCGAGTTCCTGCTGGCTGGGGCCGGAGGG
                  ************************************************************

HsCD00353937      GCCGGGGCGGGGGCCGCGCCCGGACCGCATCTCCCCCCACGGGGGTCGGTGCCTGGGGAT
NM_017582.6       GCCGGGGCGGGGGCCGCGCCCGGACCGCATCTCCCCCCACGGGGGTCGGTGCCTGGGGAT
                  ************************************************************

HsCD00353937      CCTGTCCGCATCCACTGCAACATCACGGAGTCATACCCTGCTGTGCCCCCCATCTGGTCG
NM_017582.6       CCTGTCCGCATCCACTGCAACATCACGGAGTCATACCCTGCTGTGCCCCCCATCTGGTCG
                  ************************************************************

HsCD00353937      GTGGAGTCTGATGACCCTAACTTGGCTGCTGTCTTGGAGAGGCTGGTGGACATAAAGAAA
NM_017582.6       GTGGAGTCTGATGACCCTAACTTGGCTGCTGTCTTGGAGAGGCTGGTGGACATAAAGAAA
                  ************************************************************

HsCD00353937      GGGAATACTCTGCTATTGCAGCATCTGAAGAGGATCATCTCCGACCTGTGTAAACTCTAT
NM_017582.6       GGGAATACTCTGCTATTGCAGCATCTGAAGAGGATCATCTCCGACCTGTGTAAACTCTAT
                  ************************************************************

HsCD00353937      AACCTCCCTCAGCATCCAGATGTGGAGATGCTGGATCAACCCTTGCCAGCAGAGCAGTGC
NM_017582.6       AACCTCCCTCAGCATCCAGATGTGGAGATGCTGGATCAACCCTTGCCAGCAGAGCAGTGC
                  ************************************************************

HsCD00353937      ACACAGGAAGACGTGTCTTCAGAAGATGAAGATGAGGAGATGCCTGAGGACACAGAAGAC
NM_017582.6       ACACAGGAAGACGTGTCTTCAGAAGATGAAGATGAGGAGATGCCTGAGGACACAGAAGAC
                  ************************************************************

HsCD00353937      TTAGATCACTATGAAATGAAAGAGGAAGAGCCAGCTGAGGGCAAGAAATCTGAAGATGAT
NM_017582.6       TTAGATCACTATGAAATGAAAGAGGAAGAGCCAGCTGAGGGCAAGAAATCTGAAGATGAT
                  ************************************************************

HsCD00353937      GGCATTGGAAAAGAAAACTTGGCCATCCTAGAGAAAATTAAAAAGAACCAGAGGCAAGAT
NM_017582.6       GGCATTGGAAAAGAAAACTTGGCCATCCTAGAGAAAATTAAAAAGAACCAGAGGCAAGAT
                  ************************************************************

HsCD00353937      TACTTAAATGGTGCAGTGTCTGGCTCGGTGCAGGCCACTGACCGGCTGATGAAGGAGCTC
NM_017582.6       TACTTAAATGGTGCAGTGTCTGGCTCGGTGCAGGCCACTGACCGGCTGATGAAGGAGCTC
                  ************************************************************

HsCD00353937      AGGGATATATACCGATCACAGAGTTTCAAAGGCGGAAACTATGCAGTCGAACTCGTGAAT
NM_017582.6       AGGGATATATACCGATCACAGAGTTTCAAAGGCGGAAACTATGCAGTCGAACTCGTGAAT
                  ************************************************************

HsCD00353937      GACAGTCTGTATGATTGGAATGTCAAACTCCTCAAAGTTGACCAGGACAGCGCTTTGCAC
NM_017582.6       GACAGTCTGTATGATTGGAATGTCAAACTCCTCAAAGTTGACCAGGACAGCGCTTTGCAC
                  ************************************************************

HsCD00353937      AACGATCTCCAGATCCTCAAAGAGAAAGAAGGAGCCGACTTCATTCTACTTAACTTTTCC
NM_017582.6       AACGATCTCCAGATCCTCAAAGAGAAAGAAGGAGCCGACTTCATTCTACTTAACTTTTCC
                  ************************************************************

HsCD00353937      TTTAAAGATAACTTTCCCTTTGACCCACCATTTGTCAGGGTTGTGTCTCCAGTCCTCTCT
NM_017582.6       TTTAAAGATAACTTTCCCTTTGACCCACCATTTGTCAGGGTTGTGTCTCCAGTCCTCTCT
                  ************************************************************

HsCD00353937      GGAGGGTATGTTCTGGGCGGAGGGGCCATCTGCATGGAACTTCTCACCAAACAGGGCTGG
NM_017582.6       GGAGGGTATGTTCTGGGCGGAGGGGCCATCTGCATGGAACTTCTCACCAAACAGGGCTGG
                  ************************************************************

HsCD00353937      AGCAGTGCCTACTCCATAGAGTCAGTGATCATGCAGATCAGTGCCACACTGGTGAAGGGG
NM_017582.6       AGCAGTGCCTACTCCATAGAGTCAGTGATCATGCAGATCAGTGCCACACTGGTGAAGGGG
                  ************************************************************

HsCD00353937      AAAGCACGAGTGCAGTTTGGAGCCAACAAATCTCAATACAGTCTGACAAGAGCACAGCAG
NM_017582.6       AAAGCACGAGTGCAGTTTGGAGCCAACAAATCTCAATACAGTCTGACAAGAGCACAGCAG
                  ************************************************************

HsCD00353937      TCCTACAAGTCCTTGGTGCAGATCCACGAAAAAAACGGCTGGTACACACCCCCAAAAGAA
NM_017582.6       TCCTACAAGTCCTTGGTGCAGATCCACGAAAAAAACGGCTGGTACACACCCCCAAAAGAA
                  ************************************************************

HsCD00353937      GACGGCTAG
NM_017582.6       GACGGCTAA
                  ********.

Pathways

Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Immune System

Clone

Cloning Information : 571939

Organism


TAX_ID : 9606
Species Specific ID: 55585

Genome

Chromosome : 1
Map Location : 1q21.3
Ensembl : ENSG00000160714

Reagents

Labome : UBE2Q1-antibody