DNASU Plasmid Repository • 480.965.5697 | Email

POLR2E (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  POLR2E
Gene Name:  polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
Sequence              Map: pANT7_cGST.doc
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: generated from ORFeome entry clone (IMAGE:100071791)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00356117

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 630nts         Open reading frame : 1 to 630
Reference Sequence Alignment

ATGGACGACGAGGAGGAGACGTACCGGCTCTGGAAAATCCGCAAGACCATCATGCAGCTG
TGCCACGACCGTGGCTATCTGGTGACCCAGGACGAGCTTGACCAGACCCTGGAGGAGTTC
AAAGCCCAATTTGGGGACAAGCCGAGTGAGGGGCGGCCGCGGCGCACGGACCTCACCGTG
CTGGTGGCCCACAACGATGACCCCACCGACCAGATGTTTGTGTTCTTTCCAGAGGAGCCC
AAGGTGGGCATCAAGACCATCAAGGTGTACTGCCAGCGCATGCAGGAGGAGAACATCACA
CGGGCTCTCATCGTGGTGCAGCAGGGCATGACACCCTCCGCCAAGCAGTCCCTGGTCGAC
ATGGCCCCCAAGTACATCCTGGAGCAGTTTCTGCAGCAGGAGCTGCTCATCAACATCACG
GAGCACGAGCTAGTCCCTGAGCACGTCGTCATGACCAAGGAGGAGGTGACAGAGCTGCTG
GCCCGATATAAGCTCCGAGAGAACCAGCTGCCCAGGATCCAGGCGGGGGACCCTGTGGCG
CGCTACTTTGGGATAAAGCGTGGGCAGGTGGTGAAGATCATCCGGCCCAGTGAGACGGCT
GGCAGGTACATCACCTACCGGCTGGTGCAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : POLR2E
Symbol Nomenclature : POLR2E
SYNONYM : RPABC1; RPB5; XAP4; hRPB25; hsRPB5
Designation : DNA directed RNA polymerase II 23 kda polypeptide|DNA-directed RNA polymerase II 23 kDa polypeptide|DNA-directed RNA polymerase II subunit E|DNA-directed RNA polymerases I, II, and III subunit RPABC1|RNA polymerases I, II, and III subunit ABC1|RPB5 homolog
Full Nomenclature : polymerase (RNA) II (DNA directed) polypeptide E, 25kDa
GENEID : 5434
GenBank Accession : 567129
HGNC : 9192
MIM : 180664
Target GenBank: HQ448367

 

Reference Sequence Alignment

  

HsCD00356117      ATGGACGACGAGGAGGAGACGTACCGGCTCTGGAAAATCCGCAAGACCATCATGCAGCTG
NM_002695.3       ATGGACGACGAGGAGGAGACGTACCGGCTCTGGAAAATCCGCAAGACCATCATGCAGCTG
                  ************************************************************

HsCD00356117      TGCCACGACCGTGGCTATCTGGTGACCCAGGACGAGCTTGACCAGACCCTGGAGGAGTTC
NM_002695.3       TGCCACGACCGTGGCTATCTGGTGACCCAGGACGAGCTTGACCAGACCCTGGAGGAGTTC
                  ************************************************************

HsCD00356117      AAAGCCCAATTTGGGGACAAGCCGAGTGAGGGGCGGCCGCGGCGCACGGACCTCACCGTG
NM_002695.3       AAAGCCCAATTTGGGGACAAGCCGAGTGAGGGGCGGCCGCGGCGCACGGACCTCACCGTG
                  ************************************************************

HsCD00356117      CTGGTGGCCCACAACGATGACCCCACCGACCAGATGTTTGTGTTCTTTCCAGAGGAGCCC
NM_002695.3       CTGGTGGCCCACAACGATGACCCCACCGACCAGATGTTTGTGTTCTTTCCAGAGGAGCCC
                  ************************************************************

HsCD00356117      AAGGTGGGCATCAAGACCATCAAGGTGTACTGCCAGCGCATGCAGGAGGAGAACATCACA
NM_002695.3       AAGGTGGGCATCAAGACCATCAAGGTGTACTGCCAGCGCATGCAGGAGGAGAACATCACA
                  ************************************************************

HsCD00356117      CGGGCTCTCATCGTGGTGCAGCAGGGCATGACACCCTCCGCCAAGCAGTCCCTGGTCGAC
NM_002695.3       CGGGCTCTCATCGTGGTGCAGCAGGGCATGACACCCTCCGCCAAGCAGTCCCTGGTCGAC
                  ************************************************************

HsCD00356117      ATGGCCCCCAAGTACATCCTGGAGCAGTTTCTGCAGCAGGAGCTGCTCATCAACATCACG
NM_002695.3       ATGGCCCCCAAGTACATCCTGGAGCAGTTTCTGCAGCAGGAGCTGCTCATCAACATCACG
                  ************************************************************

HsCD00356117      GAGCACGAGCTAGTCCCTGAGCACGTCGTCATGACCAAGGAGGAGGTGACAGAGCTGCTG
NM_002695.3       GAGCACGAGCTAGTCCCTGAGCACGTCGTCATGACCAAGGAGGAGGTGACAGAGCTGCTG
                  ************************************************************

HsCD00356117      GCCCGATATAAGCTCCGAGAGAACCAGCTGCCCAGGATCCAGGCGGGGGACCCTGTGGCG
NM_002695.3       GCCCGATATAAGCTCCGAGAGAACCAGCTGCCCAGGATCCAGGCGGGGGACCCTGTGGCG
                  ************************************************************

HsCD00356117      CGCTACTTTGGGATAAAGCGTGGGCAGGTGGTGAAGATCATCCGGCCCAGTGAGACGGCT
NM_002695.3       CGCTACTTTGGGATAAAGCGTGGGCAGGTGGTGAAGATCATCCGGCCCAGTGAGACGGCT
                  ************************************************************

HsCD00356117      GGCAGGTACATCACCTACCGGCTGGTGCAG---
NM_002695.3       GGCAGGTACATCACCTACCGGCTGGTGCAGTAG
                  ******************************   

Pathways

Panther : Transcription regulation by bZIP transcription factor
Reactome : Abortive elongation of HIV-1 transcript in the absence of Tat
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DNA Repair
Reactome : Disease
Reactome : Dual incision reaction in TC-NER
Reactome : Elongation arrest and recovery
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Formation of the Early Elongation Complex
Reactome : Formation of the HIV-1 Early Elongation Complex
Reactome : Formation of transcription-coupled NER (TC-NER) repair complex
Reactome : Gene Expression
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : HIV Transcription Initiation
Reactome : HIV elongation arrest and recovery
Reactome : Immune System
Reactome : Influenza Infection
Reactome : Influenza Life Cycle
Reactome : Influenza Viral RNA Transcription and Replication
Reactome : Innate Immune System
Reactome : Late Phase of HIV Life Cycle
Reactome : MicroRNA (miRNA) biogenesis
Reactome : Nucleotide Excision Repair
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : Processing of Capped Intron-Containing Pre-mRNA
Reactome : RNA Pol II CTD phosphorylation and interaction with CE
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : RNA Polymerase II HIV Promoter Escape
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Promoter Escape
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : RNA Polymerase II Transcription Initiation
Reactome : RNA Polymerase II Transcription Initiation And Promoter Clearance
Reactome : RNA Polymerase II Transcription Pre-Initiation And Promoter Opening
Reactome : RNA Polymerase III Abortive And Retractive Initiation
Reactome : RNA Polymerase III Chain Elongation
Reactome : RNA Polymerase III Transcription
Reactome : RNA Polymerase III Transcription Initiation
Reactome : RNA Polymerase III Transcription Initiation From Type 1 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 2 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 3 Promoter
Reactome : RNA Polymerase III Transcription Termination
Reactome : Regulatory RNA pathways
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcription-coupled NER (TC-NER)
Reactome : Viral Messenger RNA Synthesis
Reactome : mRNA Capping
Reactome : mRNA Splicing
Reactome : mRNA Splicing - Major Pathway
Reactome : mRNA Splicing - Minor Pathway
WikiPathway : Eukaryotic Transcription Initiation

Protein

UniProt : P19388
HPRD : 15946

Clone

Cloning Information : 567129

Organism


TAX_ID : 9606
Species Specific ID: 5434

Genome

Chromosome : 19
Map Location : 19p13.3

Reagents

Labome : POLR2E-antibody