DNASU Plasmid Repository • 480.965.5697 | Email

POLR3H (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  POLR3H
Gene Name:  polymerase (RNA) III (DNA directed) polypeptide H (22.9kD)
Sequence              Map: pANT7_cGST.doc
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: generated from ORFeome entry clone (IMAGE:100068667)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00357806

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 612nts         Open reading frame : 1 to 612
Reference Sequence Alignment

ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGG
AAGCTCAACGACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTAC
AACGTGGGACTCTGCATTTGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTC
CCTGGGGATGGCGCATCACACACCAAAGTCCATTTTCGCTGCGTGGTGTTTCATCCATTC
CTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGCAGCCCAGAAGGAGTGCACGTCTCT
CTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAGCAGCCAGCCAAGTTC
GACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACACGACCTC
TACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACG
TCCCCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAG
GAGGCTCCGTACACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGG
TGGACCAGCAAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : POLR3H
Symbol Nomenclature : POLR3H
SYNONYM : RPC22.9; RPC8
Designation : DNA-directed RNA polymerase III subunit 22.9 kDa polypeptide|DNA-directed RNA polymerase III subunit H|DNA-directed RNA polymerase III subunit RPC8|RNA nucleotidyltransferase (DNA-directed)|RNA polymerase III subunit C8
Full Nomenclature : polymerase (RNA) III (DNA directed) polypeptide H (22.9kD)
GENEID : 171568
Locus Tag : RP3-347H13.9
GenBank Accession : 570184
HGNC : 30349
Vega : OTTHUMG00000150971
Target GenBank: GQ129271

 

Reference Sequence Alignment

  

HsCD00357806        ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGG
NM_001282884.1      ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGG
NM_138338.4         ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGG
NM_001018050.3      ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGG
NM_001282885.1      ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGG
                    ************************************************************

HsCD00357806        AAGCTCAACGACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTAC
NM_001282884.1      AAGCTCAACGACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTAC
NM_138338.4         AAGCTCAACGACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTAC
NM_001018050.3      AAGCTCAACGACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTAC
NM_001282885.1      AAGCTCAACGACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTAC
                    ************************************************************

HsCD00357806        AACGTGGGACTCTGCATTTGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTC
NM_001282884.1      AACGTGGGACTCTGCATTTGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTC
NM_138338.4         AACGTGGGACTCTGCATTTGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTC
NM_001018050.3      AACGTGGGACTCTGCATTTGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTC
NM_001282885.1      AACGTGGGACTCTGCATTTGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTC
                    ************************************************************

HsCD00357806        CCTGGGGATGGCGCATCACACACCAAAGTCCATTTTCGCTGCGTGGTGTTTCATCCATTC
NM_001282884.1      CCTGGGGATGGCGCATCACACACCAAAGTCCATTTTCGCTGCGTGGTGTTTCATCCATTC
NM_138338.4         CCTGGGGATGGCGCATCACACACCAAAGTCCATTTTCGCTGCGTGGTGTTTCATCCATTC
NM_001018050.3      CCTGGGGATGGCGCATCACACACCAAAGTCCATTTTCGCTGCGTGGTGTTTCATCCATTC
NM_001282885.1      CCTGGGGATGGCGCATCACACACCAAAGTCCATTTTCGCTGCGTGGTGTTTCATCCATTC
                    ************************************************************

HsCD00357806        CTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGCAGCCCAGAAGGAGTGCACGTCTCT
NM_001282884.1      CTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGCAGCCCAGAAGGAGTGCACGTCTCT
NM_138338.4         CTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGCAGCCCAGAAGGAGTGCACGTCTCT
NM_001018050.3      CTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGCAGCCCAGAAGGAGTGCACGTCTCT
NM_001282885.1      CTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGCAGCCCAGAAGGAGTGCACGTCTCT
                    ************************************************************

HsCD00357806        CTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAGCAGCCAGCCAAGTTC
NM_001282884.1      CTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAGCAGCCAGCCAAGTTC
NM_138338.4         CTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAGCAGCCAGCCAAGTTC
NM_001018050.3      CTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAGCAGCCAGCCAAGTTC
NM_001282885.1      CTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAGCAGCCAGCCAAGTTC
                    ************************************************************

HsCD00357806        GACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACACGACCTC
NM_001282884.1      GACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACACGACCTC
NM_138338.4         GACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACACGACCTC
NM_001018050.3      GACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACACGACCTC
NM_001282885.1      GACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACACGACCTC
                    ************************************************************

HsCD00357806        TACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACG
NM_001282884.1      TACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACG
NM_138338.4         TACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACG
NM_001018050.3      TACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACG
NM_001282885.1      TACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACG
                    ************************************************************

HsCD00357806        TCCCCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAG
NM_001282884.1      TCCCCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAG
NM_138338.4         TCCCCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAG
NM_001018050.3      TCCCCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAG
NM_001282885.1      TCCCCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAG
                    ************************************************************

HsCD00357806        GAGGCTCCGTACACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGG
NM_001282884.1      GAGGCTCCGTACACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGG
NM_138338.4         GAGGCTCCGTACACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGG
NM_001018050.3      GAGGCTCCGTACACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGG
NM_001282885.1      GAGGCTCCGTACACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGG
                    ************************************************************

HsCD00357806        TGGACCAGCAAC---
NM_001282884.1      TGGACCAGCAACTAG
NM_138338.4         TGGACCAGCAACTAG
NM_001018050.3      TGGACCAGCAACTAG
NM_001282885.1      TGGACCAGCAACTAG
                    ************   

Pathways

Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Gene Expression
Reactome : Immune System
Reactome : Innate Immune System
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : RNA Polymerase III Abortive And Retractive Initiation
Reactome : RNA Polymerase III Chain Elongation
Reactome : RNA Polymerase III Transcription
Reactome : RNA Polymerase III Transcription Initiation
Reactome : RNA Polymerase III Transcription Initiation From Type 1 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 2 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 3 Promoter
Reactome : RNA Polymerase III Transcription Termination
Reactome : Transcription
WikiPathway : Eukaryotic Transcription Initiation

Protein

UniProt : Q6ZPA8
UniProt : Q9Y535
HPRD : 15157

Clone

Cloning Information : 570184

Organism


TAX_ID : 9606
Species Specific ID: 171568

Genome

Chromosome : 22
Map Location : 22q13.2
Ensembl : ENSG00000100413

Reagents

Labome : POLR3H-antibody