DNASU Plasmid Repository • 480.965.5697 | Email

PIK3R1 (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3R1
Gene Name:  phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Sequence              Map: pANT7_cGST.doc
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: generated from ORFeome entry clone (IMAGE:100071020)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00357887

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1362nts         Open reading frame : 1 to 1362
Reference Sequence Alignment

ATGTACAATACTGTTTGGAATATGGAAGACCTGGATTTAGAATATGCCAAGACAGATATA
AATTGTGGCACAGACTTGATGTTTTATATAGAAATGGACCCACCAGCACTGCCTCCTAAA
CCACCAAAACCTACTACTGTAGCCAACAACGGTATGAATAACAATATGTCCTTACAAGAT
GCTGAATGGTACTGGGGAGATATCTCGAGGGAAGAAGTGAATGAAAAACTTCGAGATACA
GCAGACGGGACCTTTTTGGTACGAGATGCGTCTACTAAAATGCATGGTGATTATACTCTT
ACACTAAGGAAAGGGGGAAATAACAAATTAATCAAAATATTTCATCGAGATGGGAAATAT
GGCTTCTCTGACCCATTAACCTTCAGTTCTGTGGTTGAATTAATAAACCACTACCGGAAT
GAATCTCTAGCTCAGTATAATCCCAAATTGGATGTGAAATTACTTTATCCAGTATCCAAA
TACCAACAGGATCAAGTTGTCAAAGAAGATAATATTGAAGCTGTAGGGAAAAAATTACAT
AAATATAACACTCAGTTTCAAGAAAAAAGTCGAGAATATGATAGATTATATGAAGAATAT
ACCCGCACATCCCAGGAAATCCAAATGAAAAGGACAGCTATTGAAGCATTTAATGAAACC
ATAAAAATATTTGAAGAACAGTGCCAGACCCAAGAGCGGTACAGCAAAGAATACATAGAA
AAGTTTAAACGTGAAGGCAATGAGAAAGAAATACAAAGGATTATGCATAATTATGATAAG
TTGAAGTCTCGAATCAGTGAAATTATTGACAGTAGAAGAAGATTGGAAGAAGACTTGAAG
AAGCAGGCAGCTGAGTATCGAGAAATTGACAAACGTATGAACAGCATTAAACCAGACCTT
ATCCAGCTGAGAAAGACGAGAGACCAATACTTGATGTGGTTGACTCAAAAAGGTGTTCGG
CAAAAGAAGTTGAACGAGTGGTTGGGCAATGAAAACACTGAAGACCAATATTCACTGGTG
GAAGATGATGAAGATTTGCCCCATCATGATGAGAAGACATGGAATGTTGGAAGCAGCAAC
CGAAACAAAGCTGAAAACCTGTTGCGAGGGAAGCGAGATGGCACTTTTCTTGTCCGGGAG
AGCAGTAAACAGGGCTGCTATGCCTGCTCTGTAGTGGTGGACGGCGAAGTAAAGCATTGT
GTCATAAACAAAACAGCAACTGGCTATGGCTTTGCCGAGCCCTATAACTTGTACAGCTCT
CTGAAAGAACTGGTGCTACATTACCAACACACCTCCCTTGTGCAGCACAACGACTCCCTC
AATGTCACACTAGCCTACCCAGTATATGCACAGCAGAGGCGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PIK3R1
Symbol Nomenclature : PIK3R1
SYNONYM : AGM7; GRB1; p85; p85-ALPHA
Designation : PI3-kinase subunit p85-alpha|PI3K regulatory subunit alpha|phosphatidylinositol 3-kinase 85 kDa regulatory subunit alpha|phosphatidylinositol 3-kinase regulatory subunit alpha|phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha)|phosphatidylinositol 3-kinase-associated p-85 alpha|phosphoinositide-3-kinase regulatory subunit|ptdIns-3-kinase regulatory subunit alpha
Full Nomenclature : phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
GENEID : 5295
GenBank Accession : 570270
HGNC : 8979
MIM : 171833
Vega : OTTHUMG00000131251
Target GenBank: HQ447692

 

Reference Sequence Alignment

  

HsCD00357887        ------------------------------------------------------------
XM_005248542.1      ATGAGTGCTGAGGGGTACCAGTACAGAGCGCTGTATGATTATAAAAAGGAAAGAGAAGAA
NM_181504.3         ------------------------------------------------------------
NM_181524.1         ------------------------------------------------------------
NM_181523.2         ATGAGTGCTGAGGGGTACCAGTACAGAGCGCTGTATGATTATAAAAAGGAAAGAGAAGAA
                                                                                

HsCD00357887        ------------------------------------------------------------
XM_005248542.1      GATATTGACTTGCACTTGGGTGACATATTGACTGTGAATAAAGGGTCCTTAGTAGCTCTT
NM_181504.3         ------------------------------------------------------------
NM_181524.1         ------------------------------------------------------------
NM_181523.2         GATATTGACTTGCACTTGGGTGACATATTGACTGTGAATAAAGGGTCCTTAGTAGCTCTT
                                                                                

HsCD00357887        ------------------------------------------------------------
XM_005248542.1      GGATTCAGTGATGGACAGGAAGCCAGGCCTGAAGAAATTGGCTGGTTAAATGGCTATAAT
NM_181504.3         ------------------------------------------------------------
NM_181524.1         ------------------------------------------------------------
NM_181523.2         GGATTCAGTGATGGACAGGAAGCCAGGCCTGAAGAAATTGGCTGGTTAAATGGCTATAAT
                                                                                

HsCD00357887        ------------------------------------------------------------
XM_005248542.1      GAAACCACAGGGGAAAGGGGGGACTTTCCGGGAACTTACGTAGAATATATTGGAAGGAAA
NM_181504.3         ------------------------------------------------------------
NM_181524.1         ------------------------------------------------------------
NM_181523.2         GAAACCACAGGGGAAAGGGGGGACTTTCCGGGAACTTACGTAGAATATATTGGAAGGAAA
                                                                                

HsCD00357887        ------------------------------------------------------------
XM_005248542.1      AAAATCTCGCCTCCCACACCAAAGCCCCGGCCACCTCGGCCTCTTCCTGTTGCACCAGGT
NM_181504.3         ------------------------------------------------------------
NM_181524.1         ------------------------------------------------------------
NM_181523.2         AAAATCTCGCCTCCCACACCAAAGCCCCGGCCACCTCGGCCTCTTCCTGTTGCACCAGGT
                                                                                

HsCD00357887        ------------------------------------------------------------
XM_005248542.1      TCTTCGAAAACTGAAGCAGATGTTGAACAACAAGCTTTGACTCTCCCGGATCTTGCAGAG
NM_181504.3         ------------------------------------------------------------
NM_181524.1         ------------------------------------------------------------
NM_181523.2         TCTTCGAAAACTGAAGCAGATGTTGAACAACAAGCTTTGACTCTCCCGGATCTTGCAGAG
                                                                                

HsCD00357887        ------------------------------------------------------------
XM_005248542.1      CAGTTTGCCCCTCCTGACATTGCCCCGCCTCTTCTTATCAAGCTCGTGGAAGCCATTGAA
NM_181504.3         ------------------------------------------------------------
NM_181524.1         ------------------------------------------------------------
NM_181523.2         CAGTTTGCCCCTCCTGACATTGCCCCGCCTCTTCTTATCAAGCTCGTGGAAGCCATTGAA
                                                                                

HsCD00357887        ------------------------------------------------------------
XM_005248542.1      AAGAAAGGTCTGGAATGTTCAACTCTATACAGAACACAGAGCTCCAGCAACCTGGCAGAA
NM_181504.3         ------------------------------------------------------------
NM_181524.1         ------------------------------------------------------------
NM_181523.2         AAGAAAGGTCTGGAATGTTCAACTCTATACAGAACACAGAGCTCCAGCAACCTGGCAGAA
                                                                                

HsCD00357887        ------------------------------------------------------------
XM_005248542.1      TTACGACAGCTTCTTGATTGTGATACACCCTCCGTGGACTTGGAAATGATCGATGTGCAC
NM_181504.3         ------------------------------------------------------------
NM_181524.1         ------------------------------------------------------------
NM_181523.2         TTACGACAGCTTCTTGATTGTGATACACCCTCCGTGGACTTGGAAATGATCGATGTGCAC
                                                                                

HsCD00357887        ------------------------------------------------------------
XM_005248542.1      GTTTTGGCTGACGCTTTCAAACGCTATCTCCTGGACTTACCAAATCCTGTCATTCCAGCA
NM_181504.3         ------------------------------------------------------------
NM_181524.1         ------------------------------------------------------------
NM_181523.2         GTTTTGGCTGACGCTTTCAAACGCTATCTCCTGGACTTACCAAATCCTGTCATTCCAGCA
                                                                                

HsCD00357887        ------------------------------------------------------------
XM_005248542.1      GCCGTTTACAGTGAAATGATTTCTTTAGCTCCAGAAGTACAAAGCTCCGAAGAATATATT
NM_181504.3         ------------------------------------------------------------
NM_181524.1         ------------------------------------------------------------
NM_181523.2         GCCGTTTACAGTGAAATGATTTCTTTAGCTCCAGAAGTACAAAGCTCCGAAGAATATATT
                                                                                

HsCD00357887        ------------------------------------------------------------
XM_005248542.1      CAGCTATTGAAGAAGCTTATTAGGTCGCCTAGCATACCTCATCAGTATTGGCTTACGCTT
NM_181504.3         ------------------------------------------------------------
NM_181524.1         ------------------------------------------------------------
NM_181523.2         CAGCTATTGAAGAAGCTTATTAGGTCGCCTAGCATACCTCATCAGTATTGGCTTACGCTT
                                                                                

HsCD00357887        ------------------------------------------------------------
XM_005248542.1      CAGTATTTGTTAAAACATTTCTTCAAGCTCTCTCAAACCTCCAGCAAAAATCTGTTGAAT
NM_181504.3         ------------------------------------------------------------
NM_181524.1         ------------------------------------------------------------
NM_181523.2         CAGTATTTGTTAAAACATTTCTTCAAGCTCTCTCAAACCTCCAGCAAAAATCTGTTGAAT
                                                                                

HsCD00357887        ------------------------------ATGTACAATACTGTTTGGAATATGGAAGAC
XM_005248542.1      GCAAGAGTACTCTCTGAAATTTTCAGCCCTATGCTTTTCAGATTCTCAGCAGCCAGCTCT
NM_181504.3         ------------------------------ATGTACAATACTGTTTGGAATATGGAAGAC
NM_181524.1         ------------------------------------------------------------
NM_181523.2         GCAAGAGTACTCTCTGAAATTTTCAGCCCTATGCTTTTCAGATTCTCAGCAGCCAGCTCT
                                                                                

HsCD00357887        CTGGATTTAGAATATGCCAAGACAGATATAAATTGTGGCACAGACTTGATGTTTTATATA
XM_005248542.1      GATAATACTGAAAACCTCATAAAAGTTATAGAAATTTTAATCTCAACTGAATGGAATGAA
NM_181504.3         CTGGATTTAGAATATGCCAAGACAGATATAAATTGTGGCACAGACTTGATGTTTTATATA
NM_181524.1         ------------------------------------------------------------
NM_181523.2         GATAATACTGAAAACCTCATAAAAGTTATAGAAATTTTAATCTCAACTGAATGGAATGAA
                                                                                

HsCD00357887        GAAATGGACCCACCAGCACTGCCTCCTAAACCACCAAAACCTACTACTGTAGCCAACAAC
XM_005248542.1      CGACAGCCTGCACCAGCACTGCCTCCTAAACCACCAAAACCTACTACTGTAGCCAACAAC
NM_181504.3         GAAATGGACCCACCAGCACTGCCTCCTAAACCACCAAAACCTACTACTGTAGCCAACAAC
NM_181524.1         ATGCATAACCTGCAAACACTGCCTCCTAAACCACCAAAACCTACTACTGTAGCCAACAAC
NM_181523.2         CGACAGCCTGCACCAGCACTGCCTCCTAAACCACCAAAACCTACTACTGTAGCCAACAAC
                      ..:  .   .*.*.********************************************

HsCD00357887        GGTATGAATAACAATATGTCCTTACAAGATGCTGAATGGTACTGGGGAGATATCTCGAGG
XM_005248542.1      GGTATGAATAACAATATGTCCTTACAAGATGCTGAATGGTACTGGGGAGATATCTCGAGG
NM_181504.3         GGTATGAATAACAATATGTCCTTACAAGATGCTGAATGGTACTGGGGAGATATCTCGAGG
NM_181524.1         GGTATGAATAACAATATGTCCTTACAAGATGCTGAATGGTACTGGGGAGATATCTCGAGG
NM_181523.2         GGTATGAATAACAATATGTCCTTACAAGATGCTGAATGGTACTGGGGAGATATCTCGAGG
                    ************************************************************

HsCD00357887        GAAGAAGTGAATGAAAAACTTCGAGATACAGCAGACGGGACCTTTTTGGTACGAGATGCG
XM_005248542.1      GAAGAAGTGAATGAAAAACTTCGAGATACAGCAGACGGGACCTTTTTGGTACGAGATGCG
NM_181504.3         GAAGAAGTGAATGAAAAACTTCGAGATACAGCAGACGGGACCTTTTTGGTACGAGATGCG
NM_181524.1         GAAGAAGTGAATGAAAAACTTCGAGATACAGCAGACGGGACCTTTTTGGTACGAGATGCG
NM_181523.2         GAAGAAGTGAATGAAAAACTTCGAGATACAGCAGACGGGACCTTTTTGGTACGAGATGCG
                    ************************************************************

HsCD00357887        TCTACTAAAATGCATGGTGATTATACTCTTACACTAAGGAAAGGGGGAAATAACAAATTA
XM_005248542.1      TCTACTAAAATGCATGGTGATTATACTCTTACACTAAGGAAAGGGGGAAATAACAAATTA
NM_181504.3         TCTACTAAAATGCATGGTGATTATACTCTTACACTAAGGAAAGGGGGAAATAACAAATTA
NM_181524.1         TCTACTAAAATGCATGGTGATTATACTCTTACACTAAGGAAAGGGGGAAATAACAAATTA
NM_181523.2         TCTACTAAAATGCATGGTGATTATACTCTTACACTAAGGAAAGGGGGAAATAACAAATTA
                    ************************************************************

HsCD00357887        ATCAAAATATTTCATCGAGATGGGAAATATGGCTTCTCTGACCCATTAACCTTCAGTTCT
XM_005248542.1      ATCAAAATATTTCATCGAGATGGGAAATATGGCTTCTCTGACCCATTAACCTTCAGTTCT
NM_181504.3         ATCAAAATATTTCATCGAGATGGGAAATATGGCTTCTCTGACCCATTAACCTTCAGTTCT
NM_181524.1         ATCAAAATATTTCATCGAGATGGGAAATATGGCTTCTCTGACCCATTAACCTTCAGTTCT
NM_181523.2         ATCAAAATATTTCATCGAGATGGGAAATATGGCTTCTCTGACCCATTAACCTTCAGTTCT
                    ************************************************************

HsCD00357887        GTGGTTGAATTAATAAACCACTACCGGAATGAATCTCTAGCTCAGTATAATCCCAAATTG
XM_005248542.1      GTGGTTGAATTAATAAACCACTACCGGAATGAATCTCTAGCTCAGTATAATCCCAAATTG
NM_181504.3         GTGGTTGAATTAATAAACCACTACCGGAATGAATCTCTAGCTCAGTATAATCCCAAATTG
NM_181524.1         GTGGTTGAATTAATAAACCACTACCGGAATGAATCTCTAGCTCAGTATAATCCCAAATTG
NM_181523.2         GTGGTTGAATTAATAAACCACTACCGGAATGAATCTCTAGCTCAGTATAATCCCAAATTG
                    ************************************************************

HsCD00357887        GATGTGAAATTACTTTATCCAGTATCCAAATACCAACAGGATCAAGTTGTCAAAGAAGAT
XM_005248542.1      GATGTGAAATTACTTTATCCAGTATCCAAATACCAACAGGATCAAGTTGTCAAAGAAGAT
NM_181504.3         GATGTGAAATTACTTTATCCAGTATCCAAATACCAACAGGATCAAGTTGTCAAAGAAGAT
NM_181524.1         GATGTGAAATTACTTTATCCAGTATCCAAATACCAACAGGATCAAGTTGTCAAAGAAGAT
NM_181523.2         GATGTGAAATTACTTTATCCAGTATCCAAATACCAACAGGATCAAGTTGTCAAAGAAGAT
                    ************************************************************

HsCD00357887        AATATTGAAGCTGTAGGGAAAAAATTACATAAATATAACACTCAGTTTCAAGAAAAAAGT
XM_005248542.1      AATATTGAAGCTGTAGGGAAAAAATTACATGAATATAACACTCAGTTTCAAGAAAAAAGT
NM_181504.3         AATATTGAAGCTGTAGGGAAAAAATTACATGAATATAACACTCAGTTTCAAGAAAAAAGT
NM_181524.1         AATATTGAAGCTGTAGGGAAAAAATTACATGAATATAACACTCAGTTTCAAGAAAAAAGT
NM_181523.2         AATATTGAAGCTGTAGGGAAAAAATTACATGAATATAACACTCAGTTTCAAGAAAAAAGT
                    ******************************.*****************************

HsCD00357887        CGAGAATATGATAGATTATATGAAGAATATACCCGCACATCCCAGGAAATCCAAATGAAA
XM_005248542.1      CGAGAATATGATAGATTATATGAAGAATATACCCGCACATCCCAGGAAATCCAAATGAAA
NM_181504.3         CGAGAATATGATAGATTATATGAAGAATATACCCGCACATCCCAGGAAATCCAAATGAAA
NM_181524.1         CGAGAATATGATAGATTATATGAAGAATATACCCGCACATCCCAGGAAATCCAAATGAAA
NM_181523.2         CGAGAATATGATAGATTATATGAAGAATATACCCGCACATCCCAGGAAATCCAAATGAAA
                    ************************************************************

HsCD00357887        AGGACAGCTATTGAAGCATTTAATGAAACCATAAAAATATTTGAAGAACAGTGCCAGACC
XM_005248542.1      AGGACAGCTATTGAAGCATTTAATGAAACCATAAAAATATTTGAAGAACAGTGCCAGACC
NM_181504.3         AGGACAGCTATTGAAGCATTTAATGAAACCATAAAAATATTTGAAGAACAGTGCCAGACC
NM_181524.1         AGGACAGCTATTGAAGCATTTAATGAAACCATAAAAATATTTGAAGAACAGTGCCAGACC
NM_181523.2         AGGACAGCTATTGAAGCATTTAATGAAACCATAAAAATATTTGAAGAACAGTGCCAGACC
                    ************************************************************

HsCD00357887        CAAGAGCGGTACAGCAAAGAATACATAGAAAAGTTTAAACGTGAAGGCAATGAGAAAGAA
XM_005248542.1      CAAGAGCGGTACAGCAAAGAATACATAGAAAAGTTTAAACGTGAAGGCAATGAGAAAGAA
NM_181504.3         CAAGAGCGGTACAGCAAAGAATACATAGAAAAGTTTAAACGTGAAGGCAATGAGAAAGAA
NM_181524.1         CAAGAGCGGTACAGCAAAGAATACATAGAAAAGTTTAAACGTGAAGGCAATGAGAAAGAA
NM_181523.2         CAAGAGCGGTACAGCAAAGAATACATAGAAAAGTTTAAACGTGAAGGCAATGAGAAAGAA
                    ************************************************************

HsCD00357887        ATACAAAGGATTATGCATAATTATGATAAGTTGAAGTCTCGAATCAGTGAAATTATTGAC
XM_005248542.1      ATACAAAGGATTATGCATAATTATGATAAGTTGAAGTCTCGAATCAGTGAAATTATTGAC
NM_181504.3         ATACAAAGGATTATGCATAATTATGATAAGTTGAAGTCTCGAATCAGTGAAATTATTGAC
NM_181524.1         ATACAAAGGATTATGCATAATTATGATAAGTTGAAGTCTCGAATCAGTGAAATTATTGAC
NM_181523.2         ATACAAAGGATTATGCATAATTATGATAAGTTGAAGTCTCGAATCAGTGAAATTATTGAC
                    ************************************************************

HsCD00357887        AGTAGAAGAAGATTGGAAGAAGACTTGAAGAAGCAGGCAGCTGAGTATCGAGAAATTGAC
XM_005248542.1      AGTAGAAGAAGATTGGAAGAAGACTTGAAGAAGCAGGCAGCTGAGTATCGAGAAATTGAC
NM_181504.3         AGTAGAAGAAGATTGGAAGAAGACTTGAAGAAGCAGGCAGCTGAGTATCGAGAAATTGAC
NM_181524.1         AGTAGAAGAAGATTGGAAGAAGACTTGAAGAAGCAGGCAGCTGAGTATCGAGAAATTGAC
NM_181523.2         AGTAGAAGAAGATTGGAAGAAGACTTGAAGAAGCAGGCAGCTGAGTATCGAGAAATTGAC
                    ************************************************************

HsCD00357887        AAACGTATGAACAGCATTAAACCAGACCTTATCCAGCTGAGAAAGACGAGAGACCAATAC
XM_005248542.1      AAACGTATGAACAGCATTAAACCAGACCTTATCCAGCTGAGAAAGACGAGAGACCAATAC
NM_181504.3         AAACGTATGAACAGCATTAAACCAGACCTTATCCAGCTGAGAAAGACGAGAGACCAATAC
NM_181524.1         AAACGTATGAACAGCATTAAACCAGACCTTATCCAGCTGAGAAAGACGAGAGACCAATAC
NM_181523.2         AAACGTATGAACAGCATTAAACCAGACCTTATCCAGCTGAGAAAGACGAGAGACCAATAC
                    ************************************************************

HsCD00357887        TTGATGTGGTTGACTCAAAAAGGTGTTCGGCAAAAGAAGTTGAACGAGTGGTTGGGCAAT
XM_005248542.1      TTGATGTGGTTGACTCAAAAAGGTGTTCGGCAAAAGAAGTTGAACGAGTGGTTGGGCAAT
NM_181504.3         TTGATGTGGTTGACTCAAAAAGGTGTTCGGCAAAAGAAGTTGAACGAGTGGTTGGGCAAT
NM_181524.1         TTGATGTGGTTGACTCAAAAAGGTGTTCGGCAAAAGAAGTTGAACGAGTGGTTGGGCAAT
NM_181523.2         TTGATGTGGTTGACTCAAAAAGGTGTTCGGCAAAAGAAGTTGAACGAGTGGTTGGGCAAT
                    ************************************************************

HsCD00357887        GAAAACACTGAAGACCAATATTCACTGGTGGAAGATGATGAAGATTTGCCCCATCATGAT
XM_005248542.1      GAAAACACTGAAGACCAATATTCACTGGTGGAAGATGATGAAGATTTGCCCCATCATGAT
NM_181504.3         GAAAACACTGAAGACCAATATTCACTGGTGGAAGATGATGAAGATTTGCCCCATCATGAT
NM_181524.1         GAAAACACTGAAGACCAATATTCACTGGTGGAAGATGATGAAGATTTGCCCCATCATGAT
NM_181523.2         GAAAACACTGAAGACCAATATTCACTGGTGGAAGATGATGAAGATTTGCCCCATCATGAT
                    ************************************************************

HsCD00357887        GAGAAGACATGGAATGTTGGAAGCAGCAACCGAAACAAAGCTGAAAACCTGTTGCGAGGG
XM_005248542.1      GAGAAGACATGGAATGTTGGAAGCAGCAACCGAAACAAAGCTGAAAACCTGTTGCGAGGG
NM_181504.3         GAGAAGACATGGAATGTTGGAAGCAGCAACCGAAACAAAGCTGAAAACCTGTTGCGAGGG
NM_181524.1         GAGAAGACATGGAATGTTGGAAGCAGCAACCGAAACAAAGCTGAAAACCTGTTGCGAGGG
NM_181523.2         GAGAAGACATGGAATGTTGGAAGCAGCAACCGAAACAAAGCTGAAAACCTGTTGCGAGGG
                    ************************************************************

HsCD00357887        AAGCGAGATGGCACTTTTCTTGTCCGGGAGAGCAGTAAACAGGGCTGCTATGCCTGCTCT
XM_005248542.1      AAGCGAGATGGCACTTTTCTTGTCCGGGAGAGCAGTAAACAGGGCTGCTATGCCTGCTCT
NM_181504.3         AAGCGAGATGGCACTTTTCTTGTCCGGGAGAGCAGTAAACAGGGCTGCTATGCCTGCTCT
NM_181524.1         AAGCGAGATGGCACTTTTCTTGTCCGGGAGAGCAGTAAACAGGGCTGCTATGCCTGCTCT
NM_181523.2         AAGCGAGATGGCACTTTTCTTGTCCGGGAGAGCAGTAAACAGGGCTGCTATGCCTGCTCT
                    ************************************************************

HsCD00357887        GTAGTGGTGGACGGCGAAGTAAAGCATTGTGTCATAAACAAAACAGCAACTGGCTATGGC
XM_005248542.1      GTAGTGGTGGACGGCGAAGTAAAGCATTGTGTCATAAACAAAACAGCAACTGGCTATGGC
NM_181504.3         GTAGTGGTGGACGGCGAAGTAAAGCATTGTGTCATAAACAAAACAGCAACTGGCTATGGC
NM_181524.1         GTAGTGGTGGACGGCGAAGTAAAGCATTGTGTCATAAACAAAACAGCAACTGGCTATGGC
NM_181523.2         GTAGTGGTGGACGGCGAAGTAAAGCATTGTGTCATAAACAAAACAGCAACTGGCTATGGC
                    ************************************************************

HsCD00357887        TTTGCCGAGCCCTATAACTTGTACAGCTCTCTGAAAGAACTGGTGCTACATTACCAACAC
XM_005248542.1      TTTGCCGAGCCCTATAACTTGTACAGCTCTCTGAAAGAACTGGTGCTACATTACCAACAC
NM_181504.3         TTTGCCGAGCCCTATAACTTGTACAGCTCTCTGAAAGAACTGGTGCTACATTACCAACAC
NM_181524.1         TTTGCCGAGCCCTATAACTTGTACAGCTCTCTGAAAGAACTGGTGCTACATTACCAACAC
NM_181523.2         TTTGCCGAGCCCTATAACTTGTACAGCTCTCTGAAAGAACTGGTGCTACATTACCAACAC
                    ************************************************************

HsCD00357887        ACCTCCCTTGTGCAGCACAACGACTCCCTCAATGTCACACTAGCCTACCCAGTATATGCA
XM_005248542.1      ACCTCCCTTGTGCAGCACAACGACTCCCTCAATGTCACACTAGCCTACCCAGTATATGCA
NM_181504.3         ACCTCCCTTGTGCAGCACAACGACTCCCTCAATGTCACACTAGCCTACCCAGTATATGCA
NM_181524.1         ACCTCCCTTGTGCAGCACAACGACTCCCTCAATGTCACACTAGCCTACCCAGTATATGCA
NM_181523.2         ACCTCCCTTGTGCAGCACAACGACTCCCTCAATGTCACACTAGCCTACCCAGTATATGCA
                    ************************************************************

HsCD00357887        CAGCAGAGGCGA---
XM_005248542.1      CAGCAGAGGCGATGA
NM_181504.3         CAGCAGAGGCGATGA
NM_181524.1         CAGCAGAGGCGATGA
NM_181523.2         CAGCAGAGGCGATGA
                    ************   

Pathways

NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Atypical NF-kappaB pathway
NCI : BCR signaling pathway
NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : E-cadherin signaling in keratinocytes
NCI : E-cadherin signaling in the nascent adherens junction
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EPHA2 forward signaling
NCI : EPHB forward signaling
NCI : EPO signaling pathway
NCI : Ephrin B reverse signaling
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : ErbB4 signaling events
NCI : FAS (CD95) signaling pathway
NCI : FGF signaling pathway
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : IFN-gamma pathway
NCI : IGF1 pathway
NCI : IL1-mediated signaling events
NCI : IL2 signaling events mediated by PI3K
NCI : IL2 signaling events mediated by STAT5
NCI : IL2-mediated signaling events
NCI : IL23-mediated signaling events
NCI : IL3-mediated signaling events
NCI : IL4-mediated signaling events
NCI : IL5-mediated signaling events
NCI : IL6-mediated signaling events
NCI : Insulin Pathway
NCI : Integrins in angiogenesis
NCI : Internalization of ErbB1
NCI : LPA receptor mediated events
NCI : N-cadherin signaling events
NCI : Nectin adhesion pathway
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Netrin-mediated signaling events
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Nongenotropic Androgen signaling
NCI : Osteopontin-mediated events
NCI : PAR1-mediated thrombin signaling events
NCI : PDGFR-alpha signaling pathway
NCI : PDGFR-beta signaling pathway
NCI : Plasma membrane estrogen receptor signaling
NCI : Reelin signaling pathway
NCI : SHP2 signaling
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by TCPTP
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling events mediated by the Hedgehog family
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : TRAIL signaling pathway
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : VEGFR1 specific signals
NCI : VEGFR3 signaling in lymphatic endothelium
NCI : a6b1 and a6b4 Integrin signaling
NCI : p75(NTR)-mediated signaling
Panther : Angiogenesis
Panther : Axon guidance mediated by netrin
Panther : Endothelin signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : PDGF signaling pathway
Panther : PI3 kinase pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : Adaptive Immune System
Reactome : Antigen activates B Cell Receptor (BCR) leading to generation of second messengers
Reactome : CD28 co-stimulation
Reactome : CD28 dependent PI3K/Akt signaling
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Costimulation by the CD28 family
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream TCR signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : G alpha (12/13) signalling events
Reactome : G alpha (q) signalling events
Reactome : GAB1 signalosome
Reactome : GP1b-IX-V activation signalling
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Interleukin-7 signaling
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nephrin interactions
Reactome : PI Metabolism
Reactome : PI-3K cascade
Reactome : PI3K Cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phospholipid metabolism
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of signaling by CBL
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Role of phospholipids in phagocytosis
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by FGFR mutants
Reactome : Signaling by FGFR1 fusion mutants
Reactome : Signaling by FGFR1 mutants
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by constitutively active EGFR
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Synthesis of PIPs at the plasma membrane
Reactome : TCR signaling
Reactome : Tie2 Signaling
WikiPathway : AMPK signaling
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : Androgen receptor signaling pathway
WikiPathway : Apoptosis
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Focal Adhesion
WikiPathway : IL-1 signaling pathway
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : IL-7 signaling pathway
WikiPathway : IL-9 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Notch Signaling Pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

SMART domain : SH2 : Src homology 2 domains
UniProt : P27986
HPRD : 01381

Clone

Cloning Information : 570270

Organism


TAX_ID : 9606
Species Specific ID: 5295

Genome

Chromosome : 5
Map Location : 5q13.1
Ensembl : ENSG00000145675

Reagents

Labome : p85-antibody