DNASU Plasmid Repository • 480.965.5697 | Email

HIF1A (Homo sapiens) in pMCSG19 (MBP and His-tagged expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HIF1A
Gene Name:  hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Sequence             
Original Clone ID: NCI10418
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pMCSG19               Format:  CLOSED
Source: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
HsCD00358151

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 2481nts         Open reading frame : 1 to 2481
Reference Sequence Alignment

ATGGAGGGCGCCGGCGGCGCGAACGACAAGAAAAAGATAAGTTCTGAACGTCGAAAAGAA
AAGTCTCGAGATGCAGCCAGATCTCGGCGAAGTAAAGAATCTGAAGTTTTTTATGAGCTT
GCTCATCAGTTGCCACTTCCACATAATGTGAGTTCGCATCTTGATAAGGCCTCTGTGATG
AGGCTTACCATCAGCTATTTGCGTGTGAGGAAACTTCTGGATGCTGGTGATTTGGATATT
GAAGATGACATGAAAGCACAGATGAATTGCTTTTATTTGAAAGCCTTGGATGGTTTTGTT
ATGGTTCTCACAGATGATGGTGACATGATTTACATTTCTGATAATGTGAACAAATACATG
GGATTAACTCAGTTTGAACTAACTGGACACAGTGTGTTTGATTTTACTCATCCATGTGAC
CATGAGGAAATGAGAGAAATGCTTACACACAGAAATGGCCTTGTGAAAAAGGGTAAAGAA
CAAAACACACAGCGAAGCTTTTTTCTCAGAATGAAGTGTACCCTAACTAGCCGAGGAAGA
ACTATGAACATAAAGTCTGCAACATGGAAGGTATTGCACTGCACAGGCCACATTCACGTA
TATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCTATGACCTGCTTG
GTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCTTTAGATAGCAAG
ACTTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGATGAAAGAATTACC
GAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTATGAATATTATCAT
GCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACTAAAGGACAAGTC
ACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGGGTTGAAACTCAA
GCAACTGTCATATATAACACCAAGAATTCTCAACCACAGTGCATTGTATGTGTGAATTAC
GTTGTGAGTGGTATTATTCAGCACGACTTGATTTTCTCCCTTCAACAAACAGAATGTGTC
CTTAAACCGGTTGAATCTTCAGATATGAAAATGACTCAGCTATTCACCAAAGTTGAATCA
GAAGATACAAGTAGCCTCTTTGACAAACTTAAGAAGGAACCTGATGCTTTAACTTTGCTG
GCCCCAGCCGCTGGAGACACAATCATATCTTTAGATTTTGGCAGCAACGACACAGAAACT
GATGACCAGCAACTTGAGGAAGTACCATTATATAATGATGTAATGCTCCCCTCACCCAAC
GAAAAATTACAGAATATAAATTTGGCAATGTCTCCATTACCCACCGCTGAAACGCCAAAG
CCACTTCGAAGTAGTGCTGACCCTGCACTCAATCAAGAAGTTGCATTAAAATTAGAACCA
AATCCAGAGTCACTGGAACTTTCTTTTACCATGCCCCAGATTCAGGATCAGACACCTAGT
CCTTCCGATGGAAGCACTAGACAAAGTTCACCTGAGCCTAATAGTCCCAGTGAATATTGT
TTTTATGTGGATAGTGATATGGTCAATGAATTCAAGTTGGAATTGGTAGAAAAACTTTTT
GCTGAAGACACAGAAGCAAAGAACCCATTTTCTACTCAGGACACAGATTTAGACTTGGAG
ATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCCTTCGATCAGTTG
TCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAAAGCACAGTTACA
GTATTCCAGCAGACTCAAATACAAGAACCTACTGCTAATGCCACCACTACCACTGCCACC
ACTGATGAATTAAAAACAGTGACAAAAGACCGTATGGAAGACATTAAAATATTGATTGCA
TCTCCATCTCCTACCCACATACATAAAGAAACTACTAGTGCCACATCATCACCATATAGA
GATACTCAAAGTCGGACAGCCTCACCAAACAGAGCAGGAAAAGGAGTCATAGAACAGACA
GAAAAATCTCATCCAAGAAGCCCTAACGTGTTATCTGTCGCTTTGAGTCAAAGAACTACA
GTTCCTGAGGAAGAACTAAATCCAAAGATACTAGCTTTGCAGAATGCTCAGAGAAAGCGA
AAAATGGAACATGATGGTTCACTTTTTCAAGCAGTAGGAATTGGAACATTATTACAGCAG
CCAGACGATCATGCAGCTACTACATCACTTTCTTGGAAACGTGTAAAAGGATGCAAATCT
AGTGAACAGAATGGAATGGAGCAAAAGACAATTATTTTAATACCCTCTGATTTAGCATGT
AGACTGCTGGGGCAATCAATGGATGAAAGTGGATTACCACAGCTGACCAGTTATGATTGT
GAAGTTAATGCTCCTATACAAGGCAGCAGAAACCTACTGCAGGGTGAAGAATTACTCAGA
GCTTTGGATCAAGTTAACTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
TCCAATGCC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Tested_Not_Soluble
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG19

pMCSG19 in advanced viewed

Synonyms: pMCSG-19
Sequencing Primer: Forward:  ANForward
Reverse:  T7 terminator
Description: Vector for solubility of insert and for purification, with T7 promoter, adds N-terminal MBP, TVMV, His, TEV, NA; amp resistance; ligation independent cloning (LIC).
Comments: pMCSG7 derivative: in vivo TVMV cleavage of MBP
Size (bp): 6441
Parent Vector: None
Empty Vector: EvNO00084265
Properties: bacterial expression, improves solubility of insert, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 16497515
Title: An expression vector tailored for large-scale, high-throughput purification of recombinant proteins

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC Ligation independent cloning (LIC) site 204 235
bacterial origin ori ColE1-type bacterial origin of replication 4416 5098
promoter T7 T7 promoter 1515 1531
protease cleavage site TVMV TVMV protease cleavage site 286 306
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 1490 1512
repressor protein gene LacI LacI coding sequence 2045 3004
selectable marker AmpR ampicillin resistance gene 5193 6053
tag His 2 C-terminal 6xHis tag 140 157
tag His 6xHis tag 268 285
tag MBP N-terminal MBP 337 1443
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HIF1A
Symbol Nomenclature : HIF1A
SYNONYM : HIF-1A; HIF-1alpha; HIF1; HIF1-ALPHA; MOP1; PASD8; bHLHe78
Designation : ARNT interacting protein|ARNT-interacting protein|HIF-1-alpha|PAS domain-containing protein 8|basic-helix-loop-helix-PAS protein MOP1|class E basic helix-loop-helix protein 78|hypoxia-inducible factor 1 alpha isoform I.3|hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)|hypoxia-inducible factor 1-alpha|hypoxia-inducible factor1alpha|member of PAS protein 1|member of PAS superfamily 1
Full Nomenclature : hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
GENEID : 3091
GI : 15214788
GenBank Accession : BC012527
HGNC : 4910
MIM : 603348
Vega : OTTHUMG00000140344
Target GenBank: BC012527

 

Reference Sequence Alignment

  

HsCD00358151        ------------------------------------------------------------
NM_001243084.1      ATGAGCTCCCAATGTCGGAGTTTGGAAAACAAATTTGTCTTTTTAAAAGAAGGTCTAGGA
NM_001530.3         ------------------------------------------------------------
                                                                                

HsCD00358151        ------------ATGGAGGGCGCCGGCGGCGCGAACGACAAGAAAAAGATAAGTTCTGAA
NM_001243084.1      AACTCAAAACCTGAAGAATTGGAAGAAATCAGAATAGAAAATGGTAGGATAAGTTCTGAA
NM_001530.3         ------------ATGGAGGGCGCCGGCGGCGCGAACGACAAGAAAAAGATAAGTTCTGAA
                                .:.**.   *..*... *. .*:.**.** ..:*.*************

HsCD00358151        CGTCGAAAAGAAAAGTCTCGAGATGCAGCCAGATCTCGGCGAAGTAAAGAATCTGAAGTT
NM_001243084.1      CGTCGAAAAGAAAAGTCTCGAGATGCAGCCAGATCTCGGCGAAGTAAAGAATCTGAAGTT
NM_001530.3         CGTCGAAAAGAAAAGTCTCGAGATGCAGCCAGATCTCGGCGAAGTAAAGAATCTGAAGTT
                    ************************************************************

HsCD00358151        TTTTATGAGCTTGCTCATCAGTTGCCACTTCCACATAATGTGAGTTCGCATCTTGATAAG
NM_001243084.1      TTTTATGAGCTTGCTCATCAGTTGCCACTTCCACATAATGTGAGTTCGCATCTTGATAAG
NM_001530.3         TTTTATGAGCTTGCTCATCAGTTGCCACTTCCACATAATGTGAGTTCGCATCTTGATAAG
                    ************************************************************

HsCD00358151        GCCTCTGTGATGAGGCTTACCATCAGCTATTTGCGTGTGAGGAAACTTCTGGATGCTGGT
NM_001243084.1      GCCTCTGTGATGAGGCTTACCATCAGCTATTTGCGTGTGAGGAAACTTCTGGATGCTGGT
NM_001530.3         GCCTCTGTGATGAGGCTTACCATCAGCTATTTGCGTGTGAGGAAACTTCTGGATGCTGGT
                    ************************************************************

HsCD00358151        GATTTGGATATTGAAGATGACATGAAAGCACAGATGAATTGCTTTTATTTGAAAGCCTTG
NM_001243084.1      GATTTGGATATTGAAGATGACATGAAAGCACAGATGAATTGCTTTTATTTGAAAGCCTTG
NM_001530.3         GATTTGGATATTGAAGATGACATGAAAGCACAGATGAATTGCTTTTATTTGAAAGCCTTG
                    ************************************************************

HsCD00358151        GATGGTTTTGTTATGGTTCTCACAGATGATGGTGACATGATTTACATTTCTGATAATGTG
NM_001243084.1      GATGGTTTTGTTATGGTTCTCACAGATGATGGTGACATGATTTACATTTCTGATAATGTG
NM_001530.3         GATGGTTTTGTTATGGTTCTCACAGATGATGGTGACATGATTTACATTTCTGATAATGTG
                    ************************************************************

HsCD00358151        AACAAATACATGGGATTAACTCAGTTTGAACTAACTGGACACAGTGTGTTTGATTTTACT
NM_001243084.1      AACAAATACATGGGATTAACTCAGTTTGAACTAACTGGACACAGTGTGTTTGATTTTACT
NM_001530.3         AACAAATACATGGGATTAACTCAGTTTGAACTAACTGGACACAGTGTGTTTGATTTTACT
                    ************************************************************

HsCD00358151        CATCCATGTGACCATGAGGAAATGAGAGAAATGCTTACACACAGAAATGGCCTTGTGAAA
NM_001243084.1      CATCCATGTGACCATGAGGAAATGAGAGAAATGCTTACACACAGAAATGGCCTTGTGAAA
NM_001530.3         CATCCATGTGACCATGAGGAAATGAGAGAAATGCTTACACACAGAAATGGCCTTGTGAAA
                    ************************************************************

HsCD00358151        AAGGGTAAAGAACAAAACACACAGCGAAGCTTTTTTCTCAGAATGAAGTGTACCCTAACT
NM_001243084.1      AAGGGTAAAGAACAAAACACACAGCGAAGCTTTTTTCTCAGAATGAAGTGTACCCTAACT
NM_001530.3         AAGGGTAAAGAACAAAACACACAGCGAAGCTTTTTTCTCAGAATGAAGTGTACCCTAACT
                    ************************************************************

HsCD00358151        AGCCGAGGAAGAACTATGAACATAAAGTCTGCAACATGGAAGGTATTGCACTGCACAGGC
NM_001243084.1      AGCCGAGGAAGAACTATGAACATAAAGTCTGCAACATGGAAGGTATTGCACTGCACAGGC
NM_001530.3         AGCCGAGGAAGAACTATGAACATAAAGTCTGCAACATGGAAGGTATTGCACTGCACAGGC
                    ************************************************************

HsCD00358151        CACATTCACGTATATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCT
NM_001243084.1      CACATTCACGTATATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCT
NM_001530.3         CACATTCACGTATATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCT
                    ************************************************************

HsCD00358151        ATGACCTGCTTGGTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCT
NM_001243084.1      ATGACCTGCTTGGTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCT
NM_001530.3         ATGACCTGCTTGGTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCT
                    ************************************************************

HsCD00358151        TTAGATAGCAAGACTTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGAT
NM_001243084.1      TTAGATAGCAAGACTTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGAT
NM_001530.3         TTAGATAGCAAGACTTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGAT
                    ************************************************************

HsCD00358151        GAAAGAATTACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTAT
NM_001243084.1      GAAAGAATTACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTAT
NM_001530.3         GAAAGAATTACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTAT
                    ************************************************************

HsCD00358151        GAATATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACT
NM_001243084.1      GAATATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACT
NM_001530.3         GAATATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACT
                    ************************************************************

HsCD00358151        AAAGGACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGG
NM_001243084.1      AAAGGACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGG
NM_001530.3         AAAGGACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGG
                    ************************************************************

HsCD00358151        GTTGAAACTCAAGCAACTGTCATATATAACACCAAGAATTCTCAACCACAGTGCATTGTA
NM_001243084.1      GTTGAAACTCAAGCAACTGTCATATATAACACCAAGAATTCTCAACCACAGTGCATTGTA
NM_001530.3         GTTGAAACTCAAGCAACTGTCATATATAACACCAAGAATTCTCAACCACAGTGCATTGTA
                    ************************************************************

HsCD00358151        TGTGTGAATTACGTTGTGAGTGGTATTATTCAGCACGACTTGATTTTCTCCCTTCAACAA
NM_001243084.1      TGTGTGAATTACGTTGTGAGTGGTATTATTCAGCACGACTTGATTTTCTCCCTTCAACAA
NM_001530.3         TGTGTGAATTACGTTGTGAGTGGTATTATTCAGCACGACTTGATTTTCTCCCTTCAACAA
                    ************************************************************

HsCD00358151        ACAGAATGTGTCCTTAAACCGGTTGAATCTTCAGATATGAAAATGACTCAGCTATTCACC
NM_001243084.1      ACAGAATGTGTCCTTAAACCGGTTGAATCTTCAGATATGAAAATGACTCAGCTATTCACC
NM_001530.3         ACAGAATGTGTCCTTAAACCGGTTGAATCTTCAGATATGAAAATGACTCAGCTATTCACC
                    ************************************************************

HsCD00358151        AAAGTTGAATCAGAAGATACAAGTAGCCTCTTTGACAAACTTAAGAAGGAACCTGATGCT
NM_001243084.1      AAAGTTGAATCAGAAGATACAAGTAGCCTCTTTGACAAACTTAAGAAGGAACCTGATGCT
NM_001530.3         AAAGTTGAATCAGAAGATACAAGTAGCCTCTTTGACAAACTTAAGAAGGAACCTGATGCT
                    ************************************************************

HsCD00358151        TTAACTTTGCTGGCCCCAGCCGCTGGAGACACAATCATATCTTTAGATTTTGGCAGCAAC
NM_001243084.1      TTAACTTTGCTGGCCCCAGCCGCTGGAGACACAATCATATCTTTAGATTTTGGCAGCAAC
NM_001530.3         TTAACTTTGCTGGCCCCAGCCGCTGGAGACACAATCATATCTTTAGATTTTGGCAGCAAC
                    ************************************************************

HsCD00358151        GACACAGAAACTGATGACCAGCAACTTGAGGAAGTACCATTATATAATGATGTAATGCTC
NM_001243084.1      GACACAGAAACTGATGACCAGCAACTTGAGGAAGTACCATTATATAATGATGTAATGCTC
NM_001530.3         GACACAGAAACTGATGACCAGCAACTTGAGGAAGTACCATTATATAATGATGTAATGCTC
                    ************************************************************

HsCD00358151        CCCTCACCCAACGAAAAATTACAGAATATAAATTTGGCAATGTCTCCATTACCCACCGCT
NM_001243084.1      CCCTCACCCAACGAAAAATTACAGAATATAAATTTGGCAATGTCTCCATTACCCACCGCT
NM_001530.3         CCCTCACCCAACGAAAAATTACAGAATATAAATTTGGCAATGTCTCCATTACCCACCGCT
                    ************************************************************

HsCD00358151        GAAACGCCAAAGCCACTTCGAAGTAGTGCTGACCCTGCACTCAATCAAGAAGTTGCATTA
NM_001243084.1      GAAACGCCAAAGCCACTTCGAAGTAGTGCTGACCCTGCACTCAATCAAGAAGTTGCATTA
NM_001530.3         GAAACGCCAAAGCCACTTCGAAGTAGTGCTGACCCTGCACTCAATCAAGAAGTTGCATTA
                    ************************************************************

HsCD00358151        AAATTAGAACCAAATCCAGAGTCACTGGAACTTTCTTTTACCATGCCCCAGATTCAGGAT
NM_001243084.1      AAATTAGAACCAAATCCAGAGTCACTGGAACTTTCTTTTACCATGCCCCAGATTCAGGAT
NM_001530.3         AAATTAGAACCAAATCCAGAGTCACTGGAACTTTCTTTTACCATGCCCCAGATTCAGGAT
                    ************************************************************

HsCD00358151        CAGACACCTAGTCCTTCCGATGGAAGCACTAGACAAAGTTCACCTGAGCCTAATAGTCCC
NM_001243084.1      CAGACACCTAGTCCTTCCGATGGAAGCACTAGACAAAGTTCACCTGAGCCTAATAGTCCC
NM_001530.3         CAGACACCTAGTCCTTCCGATGGAAGCACTAGACAAAGTTCACCTGAGCCTAATAGTCCC
                    ************************************************************

HsCD00358151        AGTGAATATTGTTTTTATGTGGATAGTGATATGGTCAATGAATTCAAGTTGGAATTGGTA
NM_001243084.1      AGTGAATATTGTTTTTATGTGGATAGTGATATGGTCAATGAATTCAAGTTGGAATTGGTA
NM_001530.3         AGTGAATATTGTTTTTATGTGGATAGTGATATGGTCAATGAATTCAAGTTGGAATTGGTA
                    ************************************************************

HsCD00358151        GAAAAACTTTTTGCTGAAGACACAGAAGCAAAGAACCCATTTTCTACTCAGGACACAGAT
NM_001243084.1      GAAAAACTTTTTGCTGAAGACACAGAAGCAAAGAACCCATTTTCTACTCAGGACACAGAT
NM_001530.3         GAAAAACTTTTTGCTGAAGACACAGAAGCAAAGAACCCATTTTCTACTCAGGACACAGAT
                    ************************************************************

HsCD00358151        TTAGACTTGGAGATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCC
NM_001243084.1      TTAGACTTGGAGATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCC
NM_001530.3         TTAGACTTGGAGATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCC
                    ************************************************************

HsCD00358151        TTCGATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAA
NM_001243084.1      TTCGATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAA
NM_001530.3         TTCGATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAA
                    ************************************************************

HsCD00358151        AGCACAGTTACAGTATTCCAGCAGACTCAAATACAAGAACCTACTGCTAATGCCACCACT
NM_001243084.1      AGCACAGTTACAGTATTCCAGCAGACTCAAATACAAGAACCTACTGCTAATGCCACCACT
NM_001530.3         AGCACAGTTACAGTATTCCAGCAGACTCAAATACAAGAACCTACTGCTAATGCCACCACT
                    ************************************************************

HsCD00358151        ACCACTGCCACCACTGATGAATTAAAAACAGTGACAAAAGACCGTATGGAAGACATTAAA
NM_001243084.1      ACCACTGCCACCACTGATGAATTAAAAACAGTGACAAAAGACCGTATGGAAGACATTAAA
NM_001530.3         ACCACTGCCACCACTGATGAATTAAAAACAGTGACAAAAGACCGTATGGAAGACATTAAA
                    ************************************************************

HsCD00358151        ATATTGATTGCATCTCCATCTCCTACCCACATACATAAAGAAACTACTAGTGCCACATCA
NM_001243084.1      ATATTGATTGCATCTCCATCTCCTACCCACATACATAAAGAAACTACTAGTGCCACATCA
NM_001530.3         ATATTGATTGCATCTCCATCTCCTACCCACATACATAAAGAAACTACTAGTGCCACATCA
                    ************************************************************

HsCD00358151        TCACCATATAGAGATACTCAAAGTCGGACAGCCTCACCAAACAGAGCAGGAAAAGGAGTC
NM_001243084.1      TCACCATATAGAGATACTCAAAGTCGGACAGCCTCACCAAACAGAGCAGGAAAAGGAGTC
NM_001530.3         TCACCATATAGAGATACTCAAAGTCGGACAGCCTCACCAAACAGAGCAGGAAAAGGAGTC
                    ************************************************************

HsCD00358151        ATAGAACAGACAGAAAAATCTCATCCAAGAAGCCCTAACGTGTTATCTGTCGCTTTGAGT
NM_001243084.1      ATAGAACAGACAGAAAAATCTCATCCAAGAAGCCCTAACGTGTTATCTGTCGCTTTGAGT
NM_001530.3         ATAGAACAGACAGAAAAATCTCATCCAAGAAGCCCTAACGTGTTATCTGTCGCTTTGAGT
                    ************************************************************

HsCD00358151        CAAAGAACTACAGTTCCTGAGGAAGAACTAAATCCAAAGATACTAGCTTTGCAGAATGCT
NM_001243084.1      CAAAGAACTACAGTTCCTGAGGAAGAACTAAATCCAAAGATACTAGCTTTGCAGAATGCT
NM_001530.3         CAAAGAACTACAGTTCCTGAGGAAGAACTAAATCCAAAGATACTAGCTTTGCAGAATGCT
                    ************************************************************

HsCD00358151        CAGAGAAAGCGAAAAATGGAACATGATGGTTCACTTTTTCAAGCAGTAGGAATTGGAACA
NM_001243084.1      CAGAGAAAGCGAAAAATGGAACATGATGGTTCACTTTTTCAAGCAGTAGGAATTGGAACA
NM_001530.3         CAGAGAAAGCGAAAAATGGAACATGATGGTTCACTTTTTCAAGCAGTAGGAATTGGAACA
                    ************************************************************

HsCD00358151        TTATTACAGCAGCCAGACGATCATGCAGCTACTACATCACTTTCTTGGAAACGTGTAAAA
NM_001243084.1      TTATTACAGCAGCCAGACGATCATGCAGCTACTACATCACTTTCTTGGAAACGTGTAAAA
NM_001530.3         TTATTACAGCAGCCAGACGATCATGCAGCTACTACATCACTTTCTTGGAAACGTGTAAAA
                    ************************************************************

HsCD00358151        GGATGCAAATCTAGTGAACAGAATGGAATGGAGCAAAAGACAATTATTTTAATACCCTCT
NM_001243084.1      GGATGCAAATCTAGTGAACAGAATGGAATGGAGCAAAAGACAATTATTTTAATACCCTCT
NM_001530.3         GGATGCAAATCTAGTGAACAGAATGGAATGGAGCAAAAGACAATTATTTTAATACCCTCT
                    ************************************************************

HsCD00358151        GATTTAGCATGTAGACTGCTGGGGCAATCAATGGATGAAAGTGGATTACCACAGCTGACC
NM_001243084.1      GATTTAGCATGTAGACTGCTGGGGCAATCAATGGATGAAAGTGGATTACCACAGCTGACC
NM_001530.3         GATTTAGCATGTAGACTGCTGGGGCAATCAATGGATGAAAGTGGATTACCACAGCTGACC
                    ************************************************************

HsCD00358151        AGTTATGATTGTGAAGTTAATGCTCCTATACAAGGCAGCAGAAACCTACTGCAGGGTGAA
NM_001243084.1      AGTTATGATTGTGAAGTTAATGCTCCTATACAAGGCAGCAGAAACCTACTGCAGGGTGAA
NM_001530.3         AGTTATGATTGTGAAGTTAATGCTCCTATACAAGGCAGCAGAAACCTACTGCAGGGTGAA
                    ************************************************************

HsCD00358151        GAATTACTCAGAGCTTTGGATCAAGTTAACTGA
NM_001243084.1      GAATTACTCAGAGCTTTGGATCAAGTTAACTGA
NM_001530.3         GAATTACTCAGAGCTTTGGATCAAGTTAACTGA
                    *********************************

Pathways

NCI : AP-1 transcription factor network
NCI : HIF-1-alpha transcription factor network
NCI : Hypoxic and oxygen homeostasis regulation of HIF-1-alpha
NCI : Notch-mediated HES/HEY network
NCI : VEGFR1 specific signals
Panther : Angiogenesis
Panther : Hypoxia response via HIF activation
Panther : VEGF signaling pathway
Reactome : Cellular response to hypoxia
Reactome : Cellular responses to stress
Reactome : Circadian Clock
Reactome : Disease
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : NOTCH1 Intracellular Domain Regulates Transcription
Reactome : Oxygen-dependent asparagine hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Oxygen-dependent proline hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Regulation of Hypoxia-inducible Factor (HIF) by oxygen
Reactome : Regulation of gene expression by Hypoxia-inducible Factor
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
WikiPathway : Adipogenesis
WikiPathway : Angiogenesis
WikiPathway : Notch Signaling Pathway

Clone

Cloning Information : 566177
HIP Master Clone ID : 476495
Original Clone ID : NCI10418

Organism


TAX_ID : 9606
Species Specific ID: 3091

Genome

Chromosome : 14
Map Location : 14q23.2
Ensembl : ENSG00000100644

Reagents

Labome : HIF-1-alpha-antibody