DNASU Plasmid Repository • 480.965.5697 | Email

ST8SIA3 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ST8SIA3
Gene Name:  ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: Glyco-enzyme clone collection
Description: All clones in the PSI Materials Repository related to human and bacterial glycosylation enzymes (Glyco-enzyme clone collection) were generated through the support of NIH grant RR005351. All users of these clones are requested to cite this grant source on all publications employing these resources
Comments: for N-term fusion (no start codon)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
Arizona State University
Kelley Moremen
University of Georgia
HsCD00358281

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 960nts         Open reading frame : 1 to 960
Reference Sequence Alignment

CAATTTGCGCTGAAGTTTCTAGACCCGTCATTCGTGCCCATTACGAATTCTCTCACCCAG
GAACTCCAAGAGAAACCTTCTAAGTGGAAATTTAATCGGACAGCGTTTTTACATCAAAGG
CAAGAAATTCTTCAGCATGTCGATGTAATAAAAAATTTTTCTTTGACCAAGAATAGTGTT
CGGATTGGACAACTGATGCACTATGATTATTCCAGCCATAAATATGTTTTCTCTATTAGC
AATAACTTCCGGTCACTTCTTCCAGATGTGTCACCCATTATGAACAAGCATTATAATATT
TGTGCTGTGGTTGGAAATAGTGGGATCCTGACAGGGAGCCAGTGTGGACAAGAAATAGAT
AAATCAGATTTTGTTTTCCGTTGCAATTTCGCCCCTACGGAGGCTTTCCAAAGAGATGTT
GGAAGAAAAACCAATCTTACCACCTTCAACCCCAGCATCCTGGAAAAATATTACAACAAT
CTCTTGACTATTCAGGACCGTAACAACTTTTTCCTCAGTTTAAAAAAGCTTGACGGGGCC
ATTCTTTGGATCCCTGCATTTTTCTTCCACACTTCAGCAACTGTGACCAGGACATTAGTT
GACTTTTTTGTTGAACACAGAGGTCAGTTAAAAGTCCAACTGGCTTGGCCGGGAAATATA
ATGCAACATGTCAACAGGTACTGGAAAAACAAACATTTGTCACCTAAACGGCTGAGCACA
GGTATTCTTATGTACACCCTTGCATCAGCAATATGTGAAGAGATCCACTTGTATGGATTT
TGGCCGTTTGGATTTGACCCCAACACAAGGGAAGATCTTCCATACCATTACTATGACAAA
AAAGGAACCAAATTTACCACCAAGTGGCAGGAGTCCCACCAGCTGCCTGCTGAGTTTCAG
CTGCTGTACCGAATGCATGGGGAAGGGCTCACCAAGCTGACTCTGTCACACTGTGCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACACATT
GATGAGCAATGCTTTTTTATAATGCCAATTTGTACAAAAAAGCAGGCTCT
GAAAACTTGTACTTTCAAGGC

3' Linker Sequence:
TAGGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTT
ATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTA
TT

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ST8SIA3
Symbol Nomenclature : ST8SIA3
SYNONYM : SIAT8C; ST8SiaIII
Designation : SIAT8-C|alpha-2,8-sialyltransferase 8C|alpha-2,8-sialyltransferase III|sia-alpha-2,3-Gal-beta-1,4-GlcNAc-R:alpha 2,8-sialyltransferase|sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)|sialyltransferase St8Sia III|sialytransferase St8Sia III
Full Nomenclature : ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
GENEID : 51046
GenBank Accession : BC074909
HGNC : 14269
MIM : 609478
Vega : OTTHUMG00000180101
Target GenBank: BC074909

 

Reference Sequence Alignment

  

HsCD00358281      ------------------------------------------------------------
NM_015879.2       ATGAGAAACTGCAAAATGGCCCGGGTCGCCAGTGTGCTGGGGCTGGTCATGCTCAGCGTC
                                                                              

HsCD00358281      ------------------------------------------------------------
NM_015879.2       GCCCTGCTGATTTTATCGCTCATCAGCTACGTGTCCCTGAAAAAGGAGAACATCTTCACC
                                                                              

HsCD00358281      ------------------------------------------------------------
NM_015879.2       ACTCCCAAGTACGCCAGCCCGGGGGCGCCCCGAATGTACATGTTCCACGCGGGATTCCGG
                                                                              

HsCD00358281      ---CAATTTGCGCTGAAGTTTCTAGACCCGTCATTCGTGCCCATTACGAATTCTCTCACC
NM_015879.2       TCACAATTTGCGCTGAAGTTTCTAGACCCGTCATTCGTGCCCATTACGAATTCTCTCACC
                     *********************************************************

HsCD00358281      CAGGAACTCCAAGAGAAACCTTCTAAGTGGAAATTTAATCGGACAGCGTTTTTACATCAA
NM_015879.2       CAGGAACTCCAAGAGAAACCTTCTAAGTGGAAATTTAATCGGACAGCGTTTTTACATCAA
                  ************************************************************

HsCD00358281      AGGCAAGAAATTCTTCAGCATGTCGATGTAATAAAAAATTTTTCTTTGACCAAGAATAGT
NM_015879.2       AGGCAAGAAATTCTTCAGCATGTCGATGTAATAAAAAATTTTTCTTTGACCAAGAATAGT
                  ************************************************************

HsCD00358281      GTTCGGATTGGACAACTGATGCACTATGATTATTCCAGCCATAAATATGTTTTCTCTATT
NM_015879.2       GTTCGGATTGGACAACTGATGCACTATGATTATTCCAGCCATAAATATGTTTTCTCTATT
                  ************************************************************

HsCD00358281      AGCAATAACTTCCGGTCACTTCTTCCAGATGTGTCACCCATTATGAACAAGCATTATAAT
NM_015879.2       AGCAATAACTTCCGGTCACTTCTTCCAGATGTGTCACCCATTATGAACAAGCATTATAAT
                  ************************************************************

HsCD00358281      ATTTGTGCTGTGGTTGGAAATAGTGGGATCCTGACAGGGAGCCAGTGTGGACAAGAAATA
NM_015879.2       ATTTGTGCTGTGGTTGGAAATAGTGGGATCCTGACAGGGAGCCAGTGTGGACAAGAAATA
                  ************************************************************

HsCD00358281      GATAAATCAGATTTTGTTTTCCGTTGCAATTTCGCCCCTACGGAGGCTTTCCAAAGAGAT
NM_015879.2       GATAAATCAGATTTTGTTTTCCGTTGCAATTTCGCCCCTACGGAGGCTTTCCAAAGAGAT
                  ************************************************************

HsCD00358281      GTTGGAAGAAAAACCAATCTTACCACCTTCAACCCCAGCATCCTGGAAAAATATTACAAC
NM_015879.2       GTTGGAAGAAAAACCAATCTTACCACCTTCAACCCCAGCATCCTGGAAAAATATTACAAC
                  ************************************************************

HsCD00358281      AATCTCTTGACTATTCAGGACCGTAACAACTTTTTCCTCAGTTTAAAAAAGCTTGACGGG
NM_015879.2       AATCTCTTGACTATTCAGGACCGTAACAACTTTTTCCTCAGTTTAAAAAAGCTTGACGGG
                  ************************************************************

HsCD00358281      GCCATTCTTTGGATCCCTGCATTTTTCTTCCACACTTCAGCAACTGTGACCAGGACATTA
NM_015879.2       GCCATTCTTTGGATCCCTGCATTTTTCTTCCACACTTCAGCAACTGTGACCAGGACATTA
                  ************************************************************

HsCD00358281      GTTGACTTTTTTGTTGAACACAGAGGTCAGTTAAAAGTCCAACTGGCTTGGCCGGGAAAT
NM_015879.2       GTTGACTTTTTTGTTGAACACAGAGGTCAGTTAAAAGTCCAACTGGCTTGGCCGGGAAAT
                  ************************************************************

HsCD00358281      ATAATGCAACATGTCAACAGGTACTGGAAAAACAAACATTTGTCACCTAAACGGCTGAGC
NM_015879.2       ATAATGCAACATGTCAACAGGTACTGGAAAAACAAACATTTGTCACCTAAACGGCTGAGC
                  ************************************************************

HsCD00358281      ACAGGTATTCTTATGTACACCCTTGCATCAGCAATATGTGAAGAGATCCACTTGTATGGA
NM_015879.2       ACAGGTATTCTTATGTACACCCTTGCATCAGCAATATGTGAAGAGATCCACTTGTATGGA
                  ************************************************************

HsCD00358281      TTTTGGCCGTTTGGATTTGACCCCAACACAAGGGAAGATCTTCCATACCATTACTATGAC
NM_015879.2       TTTTGGCCGTTTGGATTTGACCCCAACACAAGGGAAGATCTTCCATACCATTACTATGAC
                  ************************************************************

HsCD00358281      AAAAAAGGAACCAAATTTACCACCAAGTGGCAGGAGTCCCACCAGCTGCCTGCTGAGTTT
NM_015879.2       AAAAAAGGAACCAAATTTACCACCAAGTGGCAGGAGTCCCACCAGCTGCCTGCTGAGTTT
                  ************************************************************

HsCD00358281      CAGCTGCTGTACCGAATGCATGGGGAAGGGCTCACCAAGCTGACTCTGTCACACTGTGCC
NM_015879.2       CAGCTGCTGTACCGAATGCATGGGGAAGGGCTCACCAAGCTGACTCTGTCACACTGTGCC
                  ************************************************************

HsCD00358281      TAG
NM_015879.2       TAA
                  **.

Pathways

Reactome : Asparagine N-linked glycosylation
Reactome : Biosynthesis of the N-glycan precursor (dolichol lipid-linked oligosaccharide, LLO) and transfer to a nascent protein
Reactome : Metabolism of proteins
Reactome : N-Glycan antennae elongation
Reactome : N-glycan antennae elongation in the medial/trans-Golgi
Reactome : Post-translational protein modification
Reactome : Sialic acid metabolism
Reactome : Synthesis of substrates in N-glycan biosythesis
Reactome : Transport to the Golgi and subsequent modification

Protein

UniProt : O43173
UniProt : Q59GW3
HPRD : 15343

Clone

Cloning Information : 560460

Organism


TAX_ID : 9606
Species Specific ID: 51046

Genome

Chromosome : 18
Map Location : 18q21.31
Ensembl : ENSG00000177511

Reagents

Labome : ST8SIA3-antibody