DNASU Plasmid Repository • 480.965.5697 | Email

CTBS (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CTBS
Gene Name:  chitobiase, di-N-acetyl-
Sequence             
Original Clone ID: None
Keyword: partial cds (N-terminal deletion)
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: Glyco-enzyme clone collection
Description: All clones in the PSI Materials Repository related to human and bacterial glycosylation enzymes (Glyco-enzyme clone collection) were generated through the support of NIH grant RR005351. All users of these clones are requested to cite this grant source on all publications employing these resources
Comments: for N-term fusion (no start codon)
Mutation/
Discrepancy :
Yes / No
Publications: None
Authors: Center for Personalized Diagnostics
Arizona State University
Kelley Moremen
University of Georgia
HsCD00358287

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 1044nts         Open reading frame : 1 to 1044
Reference Sequence Alignment

ACCGACTGCCCATGCCCGGAGCCTGAGCTCTGCCGCCCGATTCGCCACCATCCAGATTTC
GAGGTCTTTGTGTTTGATGTTGGACAGAAAACTTGGAAATCTTATGATTGGTCACAGATT
ACAACTGTGGCAACATTTGGAAAATATGACTCAGAACTTATGTGCTACGCTCATTCAAAA
GGAGCCAGAGTAGTACTTAAAGGAGATGTATCCTTAAAGGATATCATTGATCCTGCTTTC
AGAGCATCCTGGATAGCTCAAAAACTTAATTTGGCCAAAACACAATATATGGATGGAATT
AATATAGATATAGAGCAAGAAGTTAATTGTTTATCACCTGAATATGATGCATTAACTGCT
TTAGTCAAAGAAACTACAGACTCTTTCCATCGTGAAATTGAGGGATCACAGGTAACCTTT
GATGTAGCTTGGTCTCCAAAGAACATAGACAGAAGATGCTATAATTATACTGGAATCGCA
GATGCTTGTGACTTCCTCTTTGTGATGTCTTATGATGAACAAAGTCAGATCTGGTCAGAA
TGTATTGCAGCAGCCAATGCTCCCTATAATCAGACATTAACTGGATATAATGACTACATC
AAGATGAGCATTAATCCTAAGAAACTTGTAATGGGTGTTCCTTGGTATGGTTATGATTAT
ACCTGCCTGAATCTGTCTGAGGATCATGTTTGTACCATTGCAAAAGTCCCTTTCCGGGGG
GCTCCTTGTAGTGACGCTGCAGGACGTCAGGTGCCCTACAAAACGATCATGAAGCAAATA
AATAGTTCTATTTCTGGAAACCTATGGGATAAAGATCAGCGGGCTCCTTATTATAACTAT
AAAGATCCTGCTGGCCACTTTCATCAAGTATGGTATGATAACCCTCAGAGTATTTCTTTA
AAGGCAACATATATACAAAACTATCGCTTACGGGGCATTGGCATGTGGAATGCAAACTGT
CTTGACTACTCTGGAGATGCTGTAGCCAAACAGCAAACTGAAGAAATGTGGGAAGTCTTA
AAGCCAAAGCTGTTACAGAGATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
del@1,114

Discrepancy:
None
5' Linker Sequence:
AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACACATT
GATGAGCAATGCTTTTTTATAATGCCAATTTGTACAAAAAAGCAGGCTCT
GAAAACTTGTACTTTCAAGGC

3' Linker Sequence:
TAGGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTT
ATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTA
TT

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CTBS
Symbol Nomenclature : CTBS
SYNONYM : CTB
Designation : di-N-acetylchitobiase
Full Nomenclature : chitobiase, di-N-acetyl-
GENEID : 1486
Locus Tag : RP11-118B23.5
GenBank Accession : BC126333
HGNC : 2496
MIM : 600873
Target GenBank: BC126333

 

Reference Sequence Alignment

  

HsCD00358287      ------------------------------------------------------------
NM_004388.2       ATGTCCCGGCCGCAGCTTCGACGCTGGCGCCTCGTCTCTAGCCCGCCGAGCGGCGTCCCG
                                                                              

HsCD00358287      ------------------------------------------------------ACCGAC
NM_004388.2       GGTCTAGCGCTGCTGGCGCTGCTGGCGCTGCTGGCGCTGCGGCTCGCGGCCGGGACCGAC
                                                                        ******

HsCD00358287      TGCCCATGCCCGGAGCCTGAGCTCTGCCGCCCGATTCGCCACCATCCAGATTTCGAGGTC
NM_004388.2       TGCCCATGCCCGGAGCCTGAGCTCTGCCGCCCGATTCGCCACCATCCAGATTTCGAGGTC
                  ************************************************************

HsCD00358287      TTTGTGTTTGATGTTGGACAGAAAACTTGGAAATCTTATGATTGGTCACAGATTACAACT
NM_004388.2       TTTGTGTTTGATGTTGGACAGAAAACTTGGAAATCTTATGATTGGTCACAGATTACAACT
                  ************************************************************

HsCD00358287      GTGGCAACATTTGGAAAATATGACTCAGAACTTATGTGCTACGCTCATTCAAAAGGAGCC
NM_004388.2       GTGGCAACATTTGGAAAATATGACTCAGAACTTATGTGCTACGCTCATTCAAAAGGAGCC
                  ************************************************************

HsCD00358287      AGAGTAGTACTTAAAGGAGATGTATCCTTAAAGGATATCATTGATCCTGCTTTCAGAGCA
NM_004388.2       AGAGTAGTACTTAAAGGAGATGTATCCTTAAAGGATATCATTGATCCTGCTTTCAGAGCA
                  ************************************************************

HsCD00358287      TCCTGGATAGCTCAAAAACTTAATTTGGCCAAAACACAATATATGGATGGAATTAATATA
NM_004388.2       TCCTGGATAGCTCAAAAACTTAATTTGGCCAAAACACAATATATGGATGGAATTAATATA
                  ************************************************************

HsCD00358287      GATATAGAGCAAGAAGTTAATTGTTTATCACCTGAATATGATGCATTAACTGCTTTAGTC
NM_004388.2       GATATAGAGCAAGAAGTTAATTGTTTATCACCTGAATATGATGCATTAACTGCTTTAGTC
                  ************************************************************

HsCD00358287      AAAGAAACTACAGACTCTTTCCATCGTGAAATTGAGGGATCACAGGTAACCTTTGATGTA
NM_004388.2       AAAGAAACTACAGACTCTTTCCATCGTGAAATTGAGGGATCACAGGTAACCTTTGATGTA
                  ************************************************************

HsCD00358287      GCTTGGTCTCCAAAGAACATAGACAGAAGATGCTATAATTATACTGGAATCGCAGATGCT
NM_004388.2       GCTTGGTCTCCAAAGAACATAGACAGAAGATGCTATAATTATACTGGAATCGCAGATGCT
                  ************************************************************

HsCD00358287      TGTGACTTCCTCTTTGTGATGTCTTATGATGAACAAAGTCAGATCTGGTCAGAATGTATT
NM_004388.2       TGTGACTTCCTCTTTGTGATGTCTTATGATGAACAAAGTCAGATCTGGTCAGAATGTATT
                  ************************************************************

HsCD00358287      GCAGCAGCCAATGCTCCCTATAATCAGACATTAACTGGATATAATGACTACATCAAGATG
NM_004388.2       GCAGCAGCCAATGCTCCCTATAATCAGACATTAACTGGATATAATGACTACATCAAGATG
                  ************************************************************

HsCD00358287      AGCATTAATCCTAAGAAACTTGTAATGGGTGTTCCTTGGTATGGTTATGATTATACCTGC
NM_004388.2       AGCATTAATCCTAAGAAACTTGTAATGGGTGTTCCTTGGTATGGTTATGATTATACCTGC
                  ************************************************************

HsCD00358287      CTGAATCTGTCTGAGGATCATGTTTGTACCATTGCAAAAGTCCCTTTCCGGGGGGCTCCT
NM_004388.2       CTGAATCTGTCTGAGGATCATGTTTGTACCATTGCAAAAGTCCCTTTCCGGGGGGCTCCT
                  ************************************************************

HsCD00358287      TGTAGTGACGCTGCAGGACGTCAGGTGCCCTACAAAACGATCATGAAGCAAATAAATAGT
NM_004388.2       TGTAGTGACGCTGCAGGACGTCAGGTGCCCTACAAAACGATCATGAAGCAAATAAATAGT
                  ************************************************************

HsCD00358287      TCTATTTCTGGAAACCTATGGGATAAAGATCAGCGGGCTCCTTATTATAACTATAAAGAT
NM_004388.2       TCTATTTCTGGAAACCTATGGGATAAAGATCAGCGGGCTCCTTATTATAACTATAAAGAT
                  ************************************************************

HsCD00358287      CCTGCTGGCCACTTTCATCAAGTATGGTATGATAACCCTCAGAGTATTTCTTTAAAGGCA
NM_004388.2       CCTGCTGGCCACTTTCATCAAGTATGGTATGATAACCCTCAGAGTATTTCTTTAAAGGCA
                  ************************************************************

HsCD00358287      ACATATATACAAAACTATCGCTTACGGGGCATTGGCATGTGGAATGCAAACTGTCTTGAC
NM_004388.2       ACATATATACAAAACTATCGCTTACGGGGCATTGGCATGTGGAATGCAAACTGTCTTGAC
                  ************************************************************

HsCD00358287      TACTCTGGAGATGCTGTAGCCAAACAGCAAACTGAAGAAATGTGGGAAGTCTTAAAGCCA
NM_004388.2       TACTCTGGAGATGCTGTAGCCAAACAGCAAACTGAAGAAATGTGGGAAGTCTTAAAGCCA
                  ************************************************************

HsCD00358287      AAGCTGTTACAGAGATAG
NM_004388.2       AAGCTGTTACAGAGATGA
                  ****************..

Protein

SMART domain : Glyco_18 :
UniProt : Q01459
UniProt : Q5VX50
UniProt : Q8TC97
HPRD : 02927

Clone

Cloning Information : 560488

Organism


TAX_ID : 9606
Species Specific ID: 1486

Genome

Chromosome : 1
Map Location : 1p22

Reagents

Labome : CTBS-antibody