DNASU Plasmid Repository • 480.965.5697 | Email

CCNB1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CCNB1
Gene Name:  cyclin B1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH016941.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00003616

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1302nts         Open reading frame : 1 to 1302
Reference Sequence Alignment

ATGGCGCTCCCAGTCACCAGGAACTCGAAAATTAATGCTGAAAATAAGGCGAAGATCAAC
ATGGCAGGCGCAAAGCGCGTTCCTACGGCCCCTGCTGCAACCTCCAAGCCCGGACTGAGG
CCAAGAACAGCTCTTGGGGACATTGGTAACAAAGTCAGTGAACAACTGCAGGCCAAAATG
CCTATGAAGAAGGAAGCAAAACCTTCAGCTACTGGAAAAGTCATTGATAAAAAACTACCA
AAACCTCTTGAAAAGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAG
CCAGAACCTGAGCCAGAACCTGAGCCTGTTAAAGAAGAAAAACTTTCGCCTGAGCCTATT
TTGGTTGATACTGCCTCTCCAAGCCCAATGGAAACATCTGGATGTGCCCCTGCAGAAGAA
GACCTGTGTCAGGCTTTCTCTGATGTAATTCTTGCAGTAAATGATGTGGATGCAGAAGAT
GGAGCTGATCCAAACCTTTGTAGTGAATATGTGAAAGATATTTATGCTTATCTGAGACAA
CTTGAGGAAGAGCAAGCAGTCAGACCAAAATACCTACTGGGTCGGGAAGTCACTGGAAAC
ATGAGAGCCATCCTAATTGACTGGCTAGTACAGGTTCAAATGAAATTCAGGTTGTTGCAG
GAGACCATGTACATGACTGTCTCCATTATTGATCGGTTCATGCAGAATAATTGTGTGCCC
AAGAAGATGCTGCAGCTGGTTGGTGTCACTGCCATGTTTATTGCAAGCAAATATGAAGAA
ATGTACCCTCCAGAAATTGGTGACTTTGCTTTTGTGACTGACAACACTTATACTAAGCAC
CAAATCAGACAGATGGAAATGAAGATTCTAAGAGCTTTAAACTTTGGTCTGGGTCGGCCT
CTACCTTTGCACTTCCTTCGGAGAGCATCTAAGATTGGAGAGGTTGATGTCGAGCAACAT
ACTTTGGCCAAATACCTGATGGAACTAACTATGTTGGACTATGACATGGTGCACTTTCCT
CCTTCTCAAATTGCAGCAGGAGCTTTTTGCTTAGCACTGAAAATTCTGGATAATGGTGAA
TGGACACCAACTCTACAACATTACCTGTCATATACTGAAGAATCTCTTCTTCCAGTTATG
CAGCACCTGGCTAAGAATGTAGTCATGGTAAATCAAGGACTTACAAAGCACATGACTGTC
AAGAACAAGTATGCCACATCGAAGCATGCTAAGATCAGCACTCTACCACAGCTGAATTCT
GCACTAGTTCAAGATTTAGCCAAGGCTGTGGCAAAGGTGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1406
Start on reference sequence 105
Mutations:
None
Discrepancy:
g11c,R4P
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CCNB1
Symbol Nomenclature : CCNB1
SYNONYM : CCNB
Designation : G2/mitotic-specific cyclin B1|G2/mitotic-specific cyclin-B1
Full Nomenclature : cyclin B1
GENEID : 891
GI : 60655944
GenBank Accession : AY889745
HGNC : 1579
MIM : 123836
Vega : OTTHUMG00000097817
Target GenBank: BC006510

 

Reference Sequence Alignment

  

HsCD00003616      ATGGCGCTCCCAGTCACCAGGAACTCGAAAATTAATGCTGAAAATAAGGCGAAGATCAAC
NM_031966.3       ATGGCGCTCCGAGTCACCAGGAACTCGAAAATTAATGCTGAAAATAAGGCGAAGATCAAC
                  ********** *************************************************

HsCD00003616      ATGGCAGGCGCAAAGCGCGTTCCTACGGCCCCTGCTGCAACCTCCAAGCCCGGACTGAGG
NM_031966.3       ATGGCAGGCGCAAAGCGCGTTCCTACGGCCCCTGCTGCAACCTCCAAGCCCGGACTGAGG
                  ************************************************************

HsCD00003616      CCAAGAACAGCTCTTGGGGACATTGGTAACAAAGTCAGTGAACAACTGCAGGCCAAAATG
NM_031966.3       CCAAGAACAGCTCTTGGGGACATTGGTAACAAAGTCAGTGAACAACTGCAGGCCAAAATG
                  ************************************************************

HsCD00003616      CCTATGAAGAAGGAAGCAAAACCTTCAGCTACTGGAAAAGTCATTGATAAAAAACTACCA
NM_031966.3       CCTATGAAGAAGGAAGCAAAACCTTCAGCTACTGGAAAAGTCATTGATAAAAAACTACCA
                  ************************************************************

HsCD00003616      AAACCTCTTGAAAAGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAG
NM_031966.3       AAACCTCTTGAAAAGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAG
                  ************************************************************

HsCD00003616      CCAGAACCTGAGCCAGAACCTGAGCCTGTTAAAGAAGAAAAACTTTCGCCTGAGCCTATT
NM_031966.3       CCAGAACCTGAGCCAGAACCTGAGCCTGTTAAAGAAGAAAAACTTTCGCCTGAGCCTATT
                  ************************************************************

HsCD00003616      TTGGTTGATACTGCCTCTCCAAGCCCAATGGAAACATCTGGATGTGCCCCTGCAGAAGAA
NM_031966.3       TTGGTTGATACTGCCTCTCCAAGCCCAATGGAAACATCTGGATGTGCCCCTGCAGAAGAA
                  ************************************************************

HsCD00003616      GACCTGTGTCAGGCTTTCTCTGATGTAATTCTTGCAGTAAATGATGTGGATGCAGAAGAT
NM_031966.3       GACCTGTGTCAGGCTTTCTCTGATGTAATTCTTGCAGTAAATGATGTGGATGCAGAAGAT
                  ************************************************************

HsCD00003616      GGAGCTGATCCAAACCTTTGTAGTGAATATGTGAAAGATATTTATGCTTATCTGAGACAA
NM_031966.3       GGAGCTGATCCAAACCTTTGTAGTGAATATGTGAAAGATATTTATGCTTATCTGAGACAA
                  ************************************************************

HsCD00003616      CTTGAGGAAGAGCAAGCAGTCAGACCAAAATACCTACTGGGTCGGGAAGTCACTGGAAAC
NM_031966.3       CTTGAGGAAGAGCAAGCAGTCAGACCAAAATACCTACTGGGTCGGGAAGTCACTGGAAAC
                  ************************************************************

HsCD00003616      ATGAGAGCCATCCTAATTGACTGGCTAGTACAGGTTCAAATGAAATTCAGGTTGTTGCAG
NM_031966.3       ATGAGAGCCATCCTAATTGACTGGCTAGTACAGGTTCAAATGAAATTCAGGTTGTTGCAG
                  ************************************************************

HsCD00003616      GAGACCATGTACATGACTGTCTCCATTATTGATCGGTTCATGCAGAATAATTGTGTGCCC
NM_031966.3       GAGACCATGTACATGACTGTCTCCATTATTGATCGGTTCATGCAGAATAATTGTGTGCCC
                  ************************************************************

HsCD00003616      AAGAAGATGCTGCAGCTGGTTGGTGTCACTGCCATGTTTATTGCAAGCAAATATGAAGAA
NM_031966.3       AAGAAGATGCTGCAGCTGGTTGGTGTCACTGCCATGTTTATTGCAAGCAAATATGAAGAA
                  ************************************************************

HsCD00003616      ATGTACCCTCCAGAAATTGGTGACTTTGCTTTTGTGACTGACAACACTTATACTAAGCAC
NM_031966.3       ATGTACCCTCCAGAAATTGGTGACTTTGCTTTTGTGACTGACAACACTTATACTAAGCAC
                  ************************************************************

HsCD00003616      CAAATCAGACAGATGGAAATGAAGATTCTAAGAGCTTTAAACTTTGGTCTGGGTCGGCCT
NM_031966.3       CAAATCAGACAGATGGAAATGAAGATTCTAAGAGCTTTAAACTTTGGTCTGGGTCGGCCT
                  ************************************************************

HsCD00003616      CTACCTTTGCACTTCCTTCGGAGAGCATCTAAGATTGGAGAGGTTGATGTCGAGCAACAT
NM_031966.3       CTACCTTTGCACTTCCTTCGGAGAGCATCTAAGATTGGAGAGGTTGATGTCGAGCAACAT
                  ************************************************************

HsCD00003616      ACTTTGGCCAAATACCTGATGGAACTAACTATGTTGGACTATGACATGGTGCACTTTCCT
NM_031966.3       ACTTTGGCCAAATACCTGATGGAACTAACTATGTTGGACTATGACATGGTGCACTTTCCT
                  ************************************************************

HsCD00003616      CCTTCTCAAATTGCAGCAGGAGCTTTTTGCTTAGCACTGAAAATTCTGGATAATGGTGAA
NM_031966.3       CCTTCTCAAATTGCAGCAGGAGCTTTTTGCTTAGCACTGAAAATTCTGGATAATGGTGAA
                  ************************************************************

HsCD00003616      TGGACACCAACTCTACAACATTACCTGTCATATACTGAAGAATCTCTTCTTCCAGTTATG
NM_031966.3       TGGACACCAACTCTACAACATTACCTGTCATATACTGAAGAATCTCTTCTTCCAGTTATG
                  ************************************************************

HsCD00003616      CAGCACCTGGCTAAGAATGTAGTCATGGTAAATCAAGGACTTACAAAGCACATGACTGTC
NM_031966.3       CAGCACCTGGCTAAGAATGTAGTCATGGTAAATCAAGGACTTACAAAGCACATGACTGTC
                  ************************************************************

HsCD00003616      AAGAACAAGTATGCCACATCGAAGCATGCTAAGATCAGCACTCTACCACAGCTGAATTCT
NM_031966.3       AAGAACAAGTATGCCACATCGAAGCATGCTAAGATCAGCACTCTACCACAGCTGAATTCT
                  ************************************************************

HsCD00003616      GCACTAGTTCAAGATTTAGCCAAGGCTGTGGCAAAGGTGTAG
NM_031966.3       GCACTAGTTCAAGATTTAGCCAAGGCTGTGGCAAAGGTGTAA
                  *****************************************.

Pathways

NCI : C-MYB transcription factor network
NCI : Direct p53 effectors
NCI : FOXM1 transcription factor network
NCI : FoxO family signaling
NCI : PLK1 signaling events
NCI : Validated targets of C-MYC transcriptional activation
NCI : p73 transcription factor network
Panther : p53 pathway
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of Cyclin B
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of NIMA Kinases NEK9, NEK6, NEK7
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Centrosome maturation
Reactome : Chk1/Chk2(Cds1) mediated inactivation of Cyclin B:Cdk1 complex
Reactome : Condensation of Prometaphase Chromosomes
Reactome : Condensation of Prophase Chromosomes
Reactome : Cyclin A/B1 associated events during G2/M transition
Reactome : Depolymerisation of the Nuclear Lamina
Reactome : E2F mediated regulation of DNA replication
Reactome : E2F-enabled inhibition of pre-replication complex formation
Reactome : G1/S Transition
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : G2/M DNA replication checkpoint
Reactome : G2/M Transition
Reactome : Golgi Cisternae Pericentriolar Stack Reorganization
Reactome : M Phase
Reactome : MASTL Facilitates Mitotic Progression
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prometaphase
Reactome : Mitotic Prophase
Reactome : Nuclear Envelope Breakdown
Reactome : Nuclear Pore Complex (NPC) Disassembly
Reactome : Phosphorylation of Emi1
Reactome : Phosphorylation of the APC/C
Reactome : Polo-like kinase mediated events
Reactome : Recruitment of NuMA to mitotic centrosomes
Reactome : Recruitment of mitotic centrosome proteins and complexes
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of PLK1 Activity at G2/M Transition
Reactome : Regulation of mitotic cell cycle
Reactome : Resolution of Sister Chromatid Cohesion
WikiPathway : AMPK signaling
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : G1 to S cell cycle control
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 16941
HIP Master Clone ID : 31140
Original Clone ID : FLH016941.01X

Organism


TAX_ID : 9606
Species Specific ID: 891

Genome

Chromosome : 5
Map Location : 5q12
Ensembl : ENSG00000134057

Reagents

Labome : cyclin-B1-antibody