DNASU Plasmid Repository • 480.965.5697 | Email

GPR56 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GPR56
Gene Name:  G protein-coupled receptor 56
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH026459.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00003670

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2082nts         Open reading frame : 1 to 2082
Reference Sequence Alignment

ATGACTCCCCAGTCGCTGCTGCAGACGACACTGTTCCTGCTGAGTCTGCTCTTCCTGGTC
CAAGGTGCCCACGGCAGGGGCCACAGGGAAGACTTTCGCTTCTGCAGCCAGCGGAACCAG
ACACACAGGAGCAGCCTCCACTACAAACCCACACCAGACCTGCGCATCTCCATCGAGAAC
TCCGAAGAGGCCCTCACAGTCCATGCCCCTTTCCCTGCAGCCCACCCTGCTTCCCGATCC
TTCCCTGACCCCAGGGGCCTCTACCACTTCTGCCTCTACTGGAACCGACATGCTGGGAGA
TTACATCTTCTCTATGGCAAGCGTGACTTCTTGCTGAGTGACAAAGCCTCTAGCCTCCTC
TGCTTCCAGCACCAGGAGGAGAGCCTGGCTCAGGGCCCCCCGCTGTTAGCCACTTCTGTC
ACCTCCTGGTGGAGCCCTCAGAACATCAGCCTGCCCAGTGCCGCCAGCTTCACCTTCTCC
TTCCACAGTCCTCCCCACACGGCCGCTCACAATGCCTCGGTGGACATGTGCGAGCTCAAA
AGGGACCTCCAGCTGCTCAGCCAGTTCCTGAAGCATCCCCAGAAGGCCTCAAGGAGGCCC
TCGGCTGCCCCCGCCAGCCAGCAGTTGCAGAGCCTGGAGTCGAAACTGACCTCTGTGAGA
TTCATGGGGGACATGGTGTCCTTCGAGGAGGACCGGATCAACGCCACGGTGTGGAAGCTC
CAGCCCACAGCCGGCCTCCAGGACCTGCACATCCACTCCCGGCAGGAGGAGGAGCAGAGC
GAGATCATGGAGTACTCGGTGCTGCTGCCTCGAACACTCTTCCAGAGGACGAAAGGCCGG
AGCGGGGAGGCTGAGAAGAGACTCCTCCTGGTGGACTTCAGCAGCCAAGCCCTGTTCCAG
GACAAGAATTCCAGCCACGTCCTGGGTGAGAAGGTCTTGGGGATTGTGGTACAGAACACC
AAAGTAGCCAACCTCACGGAGCCCGTGGTGCTCACCTTCCAGCACCAGCTACAGCCGAAG
AATGTGACTCTGCAATGTGTGTTCTGGGTTGAAGACCCCACATTGAGCAGCCCGGGGCAT
TGGAGCAGTGCTGGGTGTGAGACCGTCAGGAGAGAAACCCAAACATCCTGCTTCTGCAAC
CACTTGACCTACTTTGCAGTGCTGATGGTCTCCTCGGTGGAGGTGGACGCCGTGCACAAG
CACTACCTGAGCCTCCTCTCCTACGTGGGCTGTGTCGTCTCTGCCCTGGCCTGCCTTGTC
ACCATTGCCGCCTACCTCTGCTCCAGGGTGCCCCTGCCGTGCAGGAGGAAACCTCGGGAC
TACACCATCAAGGTGCACATGAACCTGCTGCTGGCCGTCTTCCTGCTGGACACGAGCTTC
CTGCTCAGCGAGCCGGTGGCCCTGACAGGCTCTGAGGCTGGCTGCCGAGCCAGTGCCATC
TTCCTGCACTTCTCCCTGCTCACCTGCCTTTCCTGGATGGGCCTCGAGGGGTACAACCTC
TACCGACTCGTGGTGGAGGTCTTTGGCACCTATGTCCCTGGCTACCTACTCAAGCTGAGC
GCCATGGGCTGGGGCTTCCCCATCTTTCTGGTGACGCTGGTGGCCCTGGTGGATGTGGAC
AACTATGGCCCCATCATCTTGGCTGTGCATAGGACTCCAGAGGGCGTCATCTACCCTTCC
ATGTGCTGGATCCGGGACTCCCTGGTCAGCTACATCACCAACCTGGGCCTCTTCAGCCTG
GTGTTTCTGTTCAACATGGCCATGCTAGCCACCATGGTGGTGCAGATCCTGCGGCTGCGC
CCCCACACCCAAAAGTGGTCACATGTGCTGACACTGCTGGGCCTCAGCCTGGTCCTTGGC
CTGCCCTGGGCCTTGATCTTCTTCTCCTTTGCTTCTGGCACCTTCCAGCTTGTCGTCCTC
TACCTTTTCAGCATCATCACCTCCTTCCAAGGCTTCCTCATCTTCATCTGGTACTGGTCC
ATGCGGCTGCAGGCCCGGGGTGGCCCCTCCCCTCTGAAGAGCAACTCAGACAGCGCCAGG
CTCCCCATCAGCTCGGGCAGCACCTCGTCCAGCCGCATCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2249
Start on reference sequence 168
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GPR56
Symbol Nomenclature : GPR56
SYNONYM : BFPP; TM7LN4; TM7XN1
Designation : 7-transmembrane protein with no EGF-like N-terminal domains-1|G-protein coupled receptor 56
Full Nomenclature : G protein-coupled receptor 56
GENEID : 9289
Locus Tag : UNQ540/PRO1083
GI : 60652912
GenBank Accession : AY892234
HGNC : 4512
MIM : 604110
Vega : OTTHUMG00000176742
Target GenBank: BC008770

 

Reference Sequence Alignment

  

HsCD00003670        ATGACTCCCCAGTCGCTGCTGCAGACGACACTGTTCCTGCTGAGTCTGCTCTTCCTG---
XM_005256239.1      ATGACTCCCCAGTCGCTGCTGCAGACGACACTGTTCCTGCTGAGTCTGCTCTTCCTGGTC
XM_005256249.1      ATGACTCCCCAGTCGCTGCTGCAGACGACACTGTTCCTGCTGAGTCTGCTCTTCCTG---
XM_005256254.1      ATGACTCCCCAGTCGCTGCTGCAGACGACACTGTTCCTGCTGAGTCTGCTCTTCCTG---
XM_005256238.1      ATGACTCCCCAGTCGCTGCTGCAGACGACACTGTTCCTGCTGAGTCTGCTCTTCCTGGTC
XM_005256237.1      ATGACTCCCCAGTCGCTGCTGCAGACGACACTGTTCCTGCTGAGTCTGCTCTTCCTGGTC
XM_005256255.1      ATGACTCCCCAGTCGCTGCTGCAGACGACACTGTTCCTGCTGAGTCTGCTCTTCCTG---
XM_005256247.1      ATGACTCCCCAGTCGCTGCTGCAGACGACACTGTTCCTGCTGAGTCTGCTCTTCCTG---
XM_005256252.1      ATGACTCCCCAGTCGCTGCTGCAGACGACACTGTTCCTGCTGAGTCTGCTCTTCCTG---
XM_005256246.1      ATGACTCCCCAGTCGCTGCTGCAGACGACACTGTTCCTGCTGAGTCTGCTCTTCCTG---
XM_005256248.1      ATGACTCCCCAGTCGCTGCTGCAGACGACACTGTTCCTGCTGAGTCTGCTCTTCCTG---
XM_005256245.1      ATGACTCCCCAGTCGCTGCTGCAGACGACACTGTTCCTGCTGAGTCTGCTCTTCCTGGTC
                    *********************************************************   

HsCD00003670        ------------GTCCAAGGTGCCCACGGCAGGGGCCACAGGGAAGACTTTCGCTTCTGC
XM_005256239.1      CAAGCCTCTGCCTCCTCAGGTGCCCACGGCAGGGGCCACAGGGAAGACTTTCGCTTCTGC
XM_005256249.1      ------------GTCCAAGGTGCCCACGGCAGGGGCCACAGGGAAGACTTTCGCTTCTGC
XM_005256254.1      ------------GTCCAAGGTGCCCACGGCAGGGGCCACAGGGAAGACTTTCGCTTCTGC
XM_005256238.1      CAAGCCTCTGCCTCCTCAGGTGCCCACGGCAGGGGCCACAGGGAAGACTTTCGCTTCTGC
XM_005256237.1      CAAGCCTCTGCCTCCTCAGGTGCCCACGGCAGGGGCCACAGGGAAGACTTTCGCTTCTGC
XM_005256255.1      ------------GTCCAAGGTGCCCACGGCAGGGGCCACAGGGAAGACTTTCGCTTCTGC
XM_005256247.1      ------------GTCCAAGGTGCCCACGGCAGGGGCCACAGGGAAGACTTTCGCTTCTGC
XM_005256252.1      ------------GTCCAAGGTGCCCACGGCAGGGGCCACAGGGAAGACTTTCGCTTCTGC
XM_005256246.1      ------------GTCCAAGGTGCCCACGGCAGGGGCCACAGGGAAGACTTTCGCTTCTGC
XM_005256248.1      ------------GTCCAAGGTGCCCACGGCAGGGGCCACAGGGAAGACTTTCGCTTCTGC
XM_005256245.1      CAAGCCTCTGCCTCCTCAGGTGCCCACGGCAGGGGCCACAGGGAAGACTTTCGCTTCTGC
                                  * .*******************************************

HsCD00003670        AGCCAGCGGAACCAGACACACAGGAGCAGCCTCCACTACAAACCCACACCAGACCTGCGC
XM_005256239.1      AGCCAGCGGAACCAGACACACAGGAGCAGCCTCCACTACAAACCCACACCAGACCTGCGC
XM_005256249.1      AGCCAGCGGAACCAGACACACAGGAGCAGCCTCCACTACAAACCCACACCAGACCTGCGC
XM_005256254.1      AGCCAGCGGAACCAGACACACAGGAGCAGCCTCCACTACAAACCCACACCAGACCTGCGC
XM_005256238.1      AGCCAGCGGAACCAGACACACAGGAGCAGCCTCCACTACAAACCCACACCAGACCTGCGC
XM_005256237.1      AGCCAGCGGAACCAGACACACAGGAGCAGCCTCCACTACAAACCCACACCAGACCTGCGC
XM_005256255.1      AGCCAGCGGAACCAGACACACAGGAGCAGCCTCCACTACAAACCCACACCAGACCTGCGC
XM_005256247.1      AGCCAGCGGAACCAGACACACAGGAGCAGCCTCCACTACAAACCCACACCAGACCTGCGC
XM_005256252.1      AGCCAGCGGAACCAGACACACAGGAGCAGCCTCCACTACAAACCCACACCAGACCTGCGC
XM_005256246.1      AGCCAGCGGAACCAGACACACAGGAGCAGCCTCCACTACAAACCCACACCAGACCTGCGC
XM_005256248.1      AGCCAGCGGAACCAGACACACAGGAGCAGCCTCCACTACAAACCCACACCAGACCTGCGC
XM_005256245.1      AGCCAGCGGAACCAGACACACAGGAGCAGCCTCCACTACAAACCCACACCAGACCTGCGC
                    ************************************************************

HsCD00003670        ATCTCCATCGAGAACTCCGAAGAGGCCCTCACAGTCCATGCCCCTTTCCCTGCAGCCCAC
XM_005256239.1      ATCTCCATCGAGAACTCCGAAGAGGCCCTCACAGTCCATGCCCCTTTCCCTGCAGCCCAC
XM_005256249.1      ATCTCCATCGAGAACTCCGAAGAGGCCCTCACAGTCCATGCCCCTTTCCCTGCAGCCCAC
XM_005256254.1      ATCTCCATCGAGAACTCCGAAGAGGCCCTCACAGTCCATGCCCCTTTCCCTGCAGCCCAC
XM_005256238.1      ATCTCCATCGAGAACTCCGAAGAGGCCCTCACAGTCCATGCCCCTTTCCCTGCAGCCCAC
XM_005256237.1      ATCTCCATCGAGAACTCCGAAGAGGCCCTCACAGTCCATGCCCCTTTCCCTGCAGCCCAC
XM_005256255.1      ATCTCCATCGAGAACTCCGAAGAGGCCCTCACAGTCCATGCCCCTTTCCCTGCAGCCCAC
XM_005256247.1      ATCTCCATCGAGAACTCCGAAGAGGCCCTCACAGTCCATGCCCCTTTCCCTGCAGCCCAC
XM_005256252.1      ATCTCCATCGAGAACTCCGAAGAGGCCCTCACAGTCCATGCCCCTTTCCCTGCAGCCCAC
XM_005256246.1      ATCTCCATCGAGAACTCCGAAGAGGCCCTCACAGTCCATGCCCCTTTCCCTGCAGCCCAC
XM_005256248.1      ATCTCCATCGAGAACTCCGAAGAGGCCCTCACAGTCCATGCCCCTTTCCCTGCAGCCCAC
XM_005256245.1      ATCTCCATCGAGAACTCCGAAGAGGCCCTCACAGTCCATGCCCCTTTCCCTGCAGCCCAC
                    ************************************************************

HsCD00003670        CCTGCTTCCCGATCCTTCCCTGACCCCAGGGGCCTCTACCACTTCTGCCTCTACTGGAAC
XM_005256239.1      CCTGCTTCCCGATCCTTCCCTGACCCCAGGGGCCTCTACCACTTCTGCCTCTACTGGAAC
XM_005256249.1      CCTGCTTCCCGATCCTTCCCTGACCCCAGGGGCCTCTACCACTTCTGCCTCTACTGGAAC
XM_005256254.1      CCTGCTTCCCGATCCTTCCCTGACCCCAGGGGCCTCTACCACTTCTGCCTCTACTGGAAC
XM_005256238.1      CCTGCTTCCCGATCCTTCCCTGACCCCAGGGGCCTCTACCACTTCTGCCTCTACTGGAAC
XM_005256237.1      CCTGCTTCCCGATCCTTCCCTGACCCCAGGGGCCTCTACCACTTCTGCCTCTACTGGAAC
XM_005256255.1      CCTGCTTCCCGATCCTTCCCTGACCCCAGGGGCCTCTACCACTTCTGCCTCTACTGGAAC
XM_005256247.1      CCTGCTTCCCGATCCTTCCCTGACCCCAGGGGCCTCTACCACTTCTGCCTCTACTGGAAC
XM_005256252.1      CCTGCTTCCCGATCCTTCCCTGACCCCAGGGGCCTCTACCACTTCTGCCTCTACTGGAAC
XM_005256246.1      CCTGCTTCCCGATCCTTCCCTGACCCCAGGGGCCTCTACCACTTCTGCCTCTACTGGAAC
XM_005256248.1      CCTGCTTCCCGATCCTTCCCTGACCCCAGGGGCCTCTACCACTTCTGCCTCTACTGGAAC
XM_005256245.1      CCTGCTTCCCGATCCTTCCCTGACCCCAGGGGCCTCTACCACTTCTGCCTCTACTGGAAC
                    ************************************************************

HsCD00003670        CGACATGCTGGGAGATTACATCTTCTCTATGGCAAGCGTGACTTCTTGCTGAGTGACAAA
XM_005256239.1      CGACATGCTGGGAGATTACATCTTCTCTATGGCAAGCGTGACTTCTTGCTGAGTGACAAA
XM_005256249.1      CGACATGCTGGGAGATTACATCTTCTCTATGGCAAGCGTGACTTCTTGCTGAGTGACAAA
XM_005256254.1      CGACATGCTGGGAGATTACATCTTCTCTATGGCAAGCGTGACTTCTTGCTGAGTGACAAA
XM_005256238.1      CGACATGCTGGGAGATTACATCTTCTCTATGGCAAGCGTGACTTCTTGCTGAGTGACAAA
XM_005256237.1      CGACATGCTGGGAGATTACATCTTCTCTATGGCAAGCGTGACTTCTTGCTGAGTGACAAA
XM_005256255.1      CGACATGCTGGGAGATTACATCTTCTCTATGGCAAGCGTGACTTCTTGCTGAGTGACAAA
XM_005256247.1      CGACATGCTGGGAGATTACATCTTCTCTATGGCAAGCGTGACTTCTTGCTGAGTGACAAA
XM_005256252.1      CGACATGCTGGGAGATTACATCTTCTCTATGGCAAGCGTGACTTCTTGCTGAGTGACAAA
XM_005256246.1      CGACATGCTGGGAGATTACATCTTCTCTATGGCAAGCGTGACTTCTTGCTGAGTGACAAA
XM_005256248.1      CGACATGCTGGGAGATTACATCTTCTCTATGGCAAGCGTGACTTCTTGCTGAGTGACAAA
XM_005256245.1      CGACATGCTGGGAGATTACATCTTCTCTATGGCAAGCGTGACTTCTTGCTGAGTGACAAA
                    ************************************************************

HsCD00003670        GCCTCTAGCCTCCTCTGCTTCCAGCACCAGGAGGAGAGCCTGGCTCAGGGCCCCCCGCTG
XM_005256239.1      GCCTCTAGCCTCCTCTGCTTCCAGCACCAGGAGGAGAGCCTGGCTCAGGGCCCCCCGCTG
XM_005256249.1      GCCTCTAGCCTCCTCTGCTTCCAGCACCAGGAGGAGAGCCTGGCTCAGGGCCCCCCGCTG
XM_005256254.1      GCCTCTAGCCTCCTCTGCTTCCAGCACCAGGAGGAGAGCCTGGCTCAGGGCCCCCCGCTG
XM_005256238.1      GCCTCTAGCCTCCTCTGCTTCCAGCACCAGGAGGAGAGCCTGGCTCAGGGCCCCCCGCTG
XM_005256237.1      GCCTCTAGCCTCCTCTGCTTCCAGCACCAGGAGGAGAGCCTGGCTCAGGGCCCCCCGCTG
XM_005256255.1      GCCTCTAGCCTCCTCTGCTTCCAGCACCAGGAGGAGAGCCTGGCTCAGGGCCCCCCGCTG
XM_005256247.1      GCCTCTAGCCTCCTCTGCTTCCAGCACCAGGAGGAGAGCCTGGCTCAGGGCCCCCCGCTG
XM_005256252.1      GCCTCTAGCCTCCTCTGCTTCCAGCACCAGGAGGAGAGCCTGGCTCAGGGCCCCCCGCTG
XM_005256246.1      GCCTCTAGCCTCCTCTGCTTCCAGCACCAGGAGGAGAGCCTGGCTCAGGGCCCCCCGCTG
XM_005256248.1      GCCTCTAGCCTCCTCTGCTTCCAGCACCAGGAGGAGAGCCTGGCTCAGGGCCCCCCGCTG
XM_005256245.1      GCCTCTAGCCTCCTCTGCTTCCAGCACCAGGAGGAGAGCCTGGCTCAGGGCCCCCCGCTG
                    ************************************************************

HsCD00003670        TTAGCCACTTCTGTCACCTCCTGGTGGAGCCCTCAGAACATCAGCCTGCCCAGTGCCGCC
XM_005256239.1      TTAGCCACTTCTGTCACCTCCTGGTGGAGCCCTCAGAACATCAGCCTGCCCAGTGCCGCC
XM_005256249.1      TTAGCCACTTCTGTCACCTCCTGGTGGAGCCCTCAGAACATCAGCCTGCCCAGTGCCGCC
XM_005256254.1      TTAGCCACTTCTGTCACCTCCTGGTGGAGCCCTCAGAACATCAGCCTGCCCAGTGCCGCC
XM_005256238.1      TTAGCCACTTCTGTCACCTCCTGGTGGAGCCCTCAGAACATCAGCCTGCCCAGTGCCGCC
XM_005256237.1      TTAGCCACTTCTGTCACCTCCTGGTGGAGCCCTCAGAACATCAGCCTGCCCAGTGCCGCC
XM_005256255.1      TTAGCCACTTCTGTCACCTCCTGGTGGAGCCCTCAGAACATCAGCCTGCCCAGTGCCGCC
XM_005256247.1      TTAGCCACTTCTGTCACCTCCTGGTGGAGCCCTCAGAACATCAGCCTGCCCAGTGCCGCC
XM_005256252.1      TTAGCCACTTCTGTCACCTCCTGGTGGAGCCCTCAGAACATCAGCCTGCCCAGTGCCGCC
XM_005256246.1      TTAGCCACTTCTGTCACCTCCTGGTGGAGCCCTCAGAACATCAGCCTGCCCAGTGCCGCC
XM_005256248.1      TTAGCCACTTCTGTCACCTCCTGGTGGAGCCCTCAGAACATCAGCCTGCCCAGTGCCGCC
XM_005256245.1      TTAGCCACTTCTGTCACCTCCTGGTGGAGCCCTCAGAACATCAGCCTGCCCAGTGCCGCC
                    ************************************************************

HsCD00003670        AGCTTCACCTTCTCCTTCCACAGTCCTCCCCACACGGCCGCTCACAATGCCTCGGTGGAC
XM_005256239.1      AGCTTCACCTTCTCCTTCCACAGTCCTCCCCACACGGCCGCTCACAATGCCTCGGTGGAC
XM_005256249.1      AGCTTCACCTTCTCCTTCCACAGTCCTCCCCACACGGCCGCTCACAATGCCTCGGTGGAC
XM_005256254.1      AGCTTCACCTTCTCCTTCCACAGTCCTCCCCACACGGCCGCTCACAATGCCTCGGTGGAC
XM_005256238.1      AGCTTCACCTTCTCCTTCCACAGTCCTCCCCACACGGCCGCTCACAATGCCTCGGTGGAC
XM_005256237.1      AGCTTCACCTTCTCCTTCCACAGTCCTCCCCACACGGCCGCTCACAATGCCTCGGTGGAC
XM_005256255.1      AGCTTCACCTTCTCCTTCCACAGTCCTCCCCACACGGCCGCTCACAATGCCTCGGTGGAC
XM_005256247.1      AGCTTCACCTTCTCCTTCCACAGTCCTCCCCACACGGCCGCTCACAATGCCTCGGTGGAC
XM_005256252.1      AGCTTCACCTTCTCCTTCCACAGTCCTCCCCACACGGCCGCTCACAATGCCTCGGTGGAC
XM_005256246.1      AGCTTCACCTTCTCCTTCCACAGTCCTCCCCACACGGCCGCTCACAATGCCTCGGTGGAC
XM_005256248.1      AGCTTCACCTTCTCCTTCCACAGTCCTCCCCACACGGCCGCTCACAATGCCTCGGTGGAC
XM_005256245.1      AGCTTCACCTTCTCCTTCCACAGTCCTCCCCACACGGCCGCTCACAATGCCTCGGTGGAC
                    ************************************************************

HsCD00003670        ATGTGCGAGCTCAAAAGGGACCTCCAGCTGCTCAGCCAGTTCCTGAAGCATCCCCAGAAG
XM_005256239.1      ATGTGCGAGCTCAAAAGGGACCTCCAGCTGCTCAGCCAGTTCCTGAAGCATCCCCAGAAG
XM_005256249.1      ATGTGCGAGCTCAAAAGGGACCTCCAGCTGCTCAGCCAGTTCCTGAAGCATCCCCAGAAG
XM_005256254.1      ATGTGCGAGCTCAAAAGGGACCTCCAGCTGCTCAGCCAGTTCCTGAAGCATCCCCAGAAG
XM_005256238.1      ATGTGCGAGCTCAAAAGGGACCTCCAGCTGCTCAGCCAGTTCCTGAAGCATCCCCAGAAG
XM_005256237.1      ATGTGCGAGCTCAAAAGGGACCTCCAGCTGCTCAGCCAGTTCCTGAAGCATCCCCAGAAG
XM_005256255.1      ATGTGCGAGCTCAAAAGGGACCTCCAGCTGCTCAGCCAGTTCCTGAAGCATCCCCAGAAG
XM_005256247.1      ATGTGCGAGCTCAAAAGGGACCTCCAGCTGCTCAGCCAGTTCCTGAAGCATCCCCAGAAG
XM_005256252.1      ATGTGCGAGCTCAAAAGGGACCTCCAGCTGCTCAGCCAGTTCCTGAAGCATCCCCAGAAG
XM_005256246.1      ATGTGCGAGCTCAAAAGGGACCTCCAGCTGCTCAGCCAGTTCCTGAAGCATCCCCAGAAG
XM_005256248.1      ATGTGCGAGCTCAAAAGGGACCTCCAGCTGCTCAGCCAGTTCCTGAAGCATCCCCAGAAG
XM_005256245.1      ATGTGCGAGCTCAAAAGGGACCTCCAGCTGCTCAGCCAGTTCCTGAAGCATCCCCAGAAG
                    ************************************************************

HsCD00003670        GCCTCAAGGAGGCCCTCGGCTGCCCCCGCCAGCCAGCAGTTGCAGAGCCTGGAGTCGAAA
XM_005256239.1      GCCTCAAGGAGGCCCTCGGCTGCCCCCGCCAGCCAGCAGTTGCAGAGCCTGGAGTCGAAA
XM_005256249.1      GCCTCAAGGAGGCCCTCGGCTGCCCCCGCCAGCCAGCAGTTGCAGAGCCTGGAGTCGAAA
XM_005256254.1      GCCTCAAGGAGGCCCTCGGCTGCCCCCGCCAGCCAGCAGTTGCAGAGCCTGGAGTCGAAA
XM_005256238.1      GCCTCAAGGAGGCCCTCGGCTGCCCCCGCCAGCCAGCAGTTGCAGAGCCTGGAGTCGAAA
XM_005256237.1      GCCTCAAGGAGGCCCTCGGCTGCCCCCGCCAGCCAGCAGTTGCAGAGCCTGGAGTCGAAA
XM_005256255.1      GCCTCAAGGAGGCCCTCGGCTGCCCCCGCCAGCCAGCAGTTGCAGAGCCTGGAGTCGAAA
XM_005256247.1      GCCTCAAGGAGGCCCTCGGCTGCCCCCGCCAGCCAGCAGTTGCAGAGCCTGGAGTCGAAA
XM_005256252.1      GCCTCAAGGAGGCCCTCGGCTGCCCCCGCCAGCCAGCAGTTGCAGAGCCTGGAGTCGAAA
XM_005256246.1      GCCTCAAGGAGGCCCTCGGCTGCCCCCGCCAGCCAGCAGTTGCAGAGCCTGGAGTCGAAA
XM_005256248.1      GCCTCAAGGAGGCCCTCGGCTGCCCCCGCCAGCCAGCAGTTGCAGAGCCTGGAGTCGAAA
XM_005256245.1      GCCTCAAGGAGGCCCTCGGCTGCCCCCGCCAGCCAGCAGTTGCAGAGCCTGGAGTCGAAA
                    ************************************************************

HsCD00003670        CTGACCTCTGTGAGATTCATGGGGGACATGGTGTCCTTCGAGGAGGACCGGATCAACGCC
XM_005256239.1      CTGACCTCTGTGAGATTCATGGGGGACATGGTGTCCTTCGAGGAGGACCGGATCAACGCC
XM_005256249.1      CTGACCTCTGTGAGATTCATGGGGGACATGGTGTCCTTCGAGGAGGACCGGATCAACGCC
XM_005256254.1      CTGACCTCTGTGAGATTCATGGGGGACATGGTGTCCTTCGAGGAGGACCGGATCAACGCC
XM_005256238.1      CTGACCTCTGTGAGATTCATGGGGGACATGGTGTCCTTCGAGGAGGACCGGATCAACGCC
XM_005256237.1      CTGACCTCTGTGAGATTCATGGGGGACATGGTGTCCTTCGAGGAGGACCGGATCAACGCC
XM_005256255.1      CTGACCTCTGTGAGATTCATGGGGGACATGGTGTCCTTCGAGGAGGACCGGATCAACGCC
XM_005256247.1      CTGACCTCTGTGAGATTCATGGGGGACATGGTGTCCTTCGAGGAGGACCGGATCAACGCC
XM_005256252.1      CTGACCTCTGTGAGATTCATGGGGGACATGGTGTCCTTCGAGGAGGACCGGATCAACGCC
XM_005256246.1      CTGACCTCTGTGAGATTCATGGGGGACATGGTGTCCTTCGAGGAGGACCGGATCAACGCC
XM_005256248.1      CTGACCTCTGTGAGATTCATGGGGGACATGGTGTCCTTCGAGGAGGACCGGATCAACGCC
XM_005256245.1      CTGACCTCTGTGAGATTCATGGGGGACATGGTGTCCTTCGAGGAGGACCGGATCAACGCC
                    ************************************************************

HsCD00003670        ACGGTGTGGAAGCTCCAGCCCACAGCCGGCCTCCAGGACCTGCACATCCACTCCCGGCAG
XM_005256239.1      ACGGTGTGGAAGCTCCAGCCCACAGCCGGCCTCCAGGACCTGCACATCCACTCCCGGCAG
XM_005256249.1      ACGGTGTGGAAGCTCCAGCCCACAGCCGGCCTCCAGGACCTGCACATCCACTCCCGGCAG
XM_005256254.1      ACGGTGTGGAAGCTCCAGCCCACAGCCGGCCTCCAGGACCTGCACATCCACTCCCGGCAG
XM_005256238.1      ACGGTGTGGAAGCTCCAGCCCACAGCCGGCCTCCAGGACCTGCACATCCACTCCCGGCAG
XM_005256237.1      ACGGTGTGGAAGCTCCAGCCCACAGCCGGCCTCCAGGACCTGCACATCCACTCCCGGCAG
XM_005256255.1      ACGGTGTGGAAGCTCCAGCCCACAGCCGGCCTCCAGGACCTGCACATCCACTCCCGGCAG
XM_005256247.1      ACGGTGTGGAAGCTCCAGCCCACAGCCGGCCTCCAGGACCTGCACATCCACTCCCGGCAG
XM_005256252.1      ACGGTGTGGAAGCTCCAGCCCACAGCCGGCCTCCAGGACCTGCACATCCACTCCCGGCAG
XM_005256246.1      ACGGTGTGGAAGCTCCAGCCCACAGCCGGCCTCCAGGACCTGCACATCCACTCCCGGCAG
XM_005256248.1      ACGGTGTGGAAGCTCCAGCCCACAGCCGGCCTCCAGGACCTGCACATCCACTCCCGGCAG
XM_005256245.1      ACGGTGTGGAAGCTCCAGCCCACAGCCGGCCTCCAGGACCTGCACATCCACTCCCGGCAG
                    ************************************************************

HsCD00003670        GAGGAGGAGCAGAGCGAGATCATGGAGTACTCGGTGCTGCTGCCTCGAACACTCTTCCAG
XM_005256239.1      GAGGAGGAGCAGAGCGAGATCATGGAGTACTCGGTGCTGCTGCCTCGAACACTCTTCCAG
XM_005256249.1      GAGGAGGAGCAGAGCGAGATCATGGAGTACTCGGTGCTGCTGCCTCGAACACTCTTCCAG
XM_005256254.1      GAGGAGGAGCAGAGCGAGATCATGGAGTACTCGGTGCTGCTGCCTCGAACACTCTTCCAG
XM_005256238.1      GAGGAGGAGCAGAGCGAGATCATGGAGTACTCGGTGCTGCTGCCTCGAACACTCTTCCAG
XM_005256237.1      GAGGAGGAGCAGAGCGAGATCATGGAGTACTCGGTGCTGCTGCCTCGAACACTCTTCCAG
XM_005256255.1      GAGGAGGAGCAGAGCGAGATCATGGAGTACTCGGTGCTGCTGCCTCGAACACTCTTCCAG
XM_005256247.1      GAGGAGGAGCAGAGCGAGATCATGGAGTACTCGGTGCTGCTGCCTCGAACACTCTTCCAG
XM_005256252.1      GAGGAGGAGCAGAGCGAGATCATGGAGTACTCGGTGCTGCTGCCTCGAACACTCTTCCAG
XM_005256246.1      GAGGAGGAGCAGAGCGAGATCATGGAGTACTCGGTGCTGCTGCCTCGAACACTCTTCCAG
XM_005256248.1      GAGGAGGAGCAGAGCGAGATCATGGAGTACTCGGTGCTGCTGCCTCGAACACTCTTCCAG
XM_005256245.1      GAGGAGGAGCAGAGCGAGATCATGGAGTACTCGGTGCTGCTGCCTCGAACACTCTTCCAG
                    ************************************************************

HsCD00003670        AGGACGAAAGGCCGGAGCGGGGAGGCTGAGAAGAGACTCCTCCTGGTGGACTTCAGCAGC
XM_005256239.1      AGGACGAAAGGCCGGAGCGGGGAGGCTGAGAAGAGACTCCTCCTGGTGGACTTCAGCAGC
XM_005256249.1      AGGACGAAAGGCCGGAGCGGGGAGGCTGAGAAGAGACTCCTCCTGGTGGACTTCAGCAGC
XM_005256254.1      AGGACGAAAGGCCGGAGCGGGGAGGCTGAGAAGAGACTCCTCCTGGTGGACTTCAGCAGC
XM_005256238.1      AGGACGAAAGGCCGGAGCGGGGAGGCTGAGAAGAGACTCCTCCTGGTGGACTTCAGCAGC
XM_005256237.1      AGGACGAAAGGCCGGAGCGGGGAGGCTGAGAAGAGACTCCTCCTGGTGGACTTCAGCAGC
XM_005256255.1      AGGACGAAAGGCCGGAGCGGGGAGGCTGAGAAGAGACTCCTCCTGGTGGACTTCAGCAGC
XM_005256247.1      AGGACGAAAGGCCGGAGCGGGGAGGCTGAGAAGAGACTCCTCCTGGTGGACTTCAGCAGC
XM_005256252.1      AGGACGAAAGGCCGGAGCGGGGAGGCTGAGAAGAGACTCCTCCTGGTGGACTTCAGCAGC
XM_005256246.1      AGGACGAAAGGCCGGAGCGGGGAGGCTGAGAAGAGACTCCTCCTGGTGGACTTCAGCAGC
XM_005256248.1      AGGACGAAAGGCCGGAGCGGGGAGGCTGAGAAGAGACTCCTCCTGGTGGACTTCAGCAGC
XM_005256245.1      AGGACGAAAGGCCGGAGCGGGGAGGCTGAGAAGAGACTCCTCCTGGTGGACTTCAGCAGC
                    ************************************************************

HsCD00003670        CAAGCCCTGTTCCAGGACAAGAATTCCAGCCACGTCCTGGGTGAGAAGGTCTTGGGGATT
XM_005256239.1      CAAGCCCTGTTCCAGGACAAGAATTCCAGCCAAGTCCTGGGTGAGAAGGTCTTGGGGATT
XM_005256249.1      CAAGCCCTGTTCCAGGACAAGAATTCCAGCCAAGTCCTGGGTGAGAAGGTCTTGGGGATT
XM_005256254.1      CAAGCCCTGTTCCAGGACAAGAATTCCAGCCAAGTCCTGGGTGAGAAGGTCTTGGGGATT
XM_005256238.1      CAAGCCCTGTTCCAGGACAAGAATTCCAGCCAAGTCCTGGGTGAGAAGGTCTTGGGGATT
XM_005256237.1      CAAGCCCTGTTCCAGGACAAGAATTCCAGCCAAGTCCTGGGTGAGAAGGTCTTGGGGATT
XM_005256255.1      CAAGCCCTGTTCCAGGACAAGAATTCCAGCCAAGTCCTGGGTGAGAAGGTCTTGGGGATT
XM_005256247.1      CAAGCCCTGTTCCAGGACAAGAATTCCAGCCAAGTCCTGGGTGAGAAGGTCTTGGGGATT
XM_005256252.1      CAAGCCCTGTTCCAGGACAAGAATTCCAGCCAAGTCCTGGGTGAGAAGGTCTTGGGGATT
XM_005256246.1      CAAGCCCTGTTCCAGGACAAGAATTCCAGCCAAGTCCTGGGTGAGAAGGTCTTGGGGATT
XM_005256248.1      CAAGCCCTGTTCCAGGACAAGAATTCCAGCCAAGTCCTGGGTGAGAAGGTCTTGGGGATT
XM_005256245.1      CAAGCCCTGTTCCAGGACAAGAATTCCAGCCAAGTCCTGGGTGAGAAGGTCTTGGGGATT
                    ********************************.***************************

HsCD00003670        GTGGTACAGAACACCAAAGTAGCCAACCTCACGGAGCCCGTGGTGCTCACCTTCCAGCAC
XM_005256239.1      GTGGTACAGAACACCAAAGTAGCCAACCTCACGGAGCCCGTGGTGCTCACTTTCCAGCAC
XM_005256249.1      GTGGTACAGAACACCAAAGTAGCCAACCTCACGGAGCCCGTGGTGCTCACTTTCCAGCAC
XM_005256254.1      GTGGTACAGAACACCAAAGTAGCCAACCTCACGGAGCCCGTGGTGCTCACTTTCCAGCAC
XM_005256238.1      GTGGTACAGAACACCAAAGTAGCCAACCTCACGGAGCCCGTGGTGCTCACTTTCCAGCAC
XM_005256237.1      GTGGTACAGAACACCAAAGTAGCCAACCTCACGGAGCCCGTGGTGCTCACTTTCCAGCAC
XM_005256255.1      GTGGTACAGAACACCAAAGTAGCCAACCTCACGGAGCCCGTGGTGCTCACTTTCCAGCAC
XM_005256247.1      GTGGTACAGAACACCAAAGTAGCCAACCTCACGGAGCCCGTGGTGCTCACTTTCCAGCAC
XM_005256252.1      GTGGTACAGAACACCAAAGTAGCCAACCTCACGGAGCCCGTGGTGCTCACTTTCCAGCAC
XM_005256246.1      GTGGTACAGAACACCAAAGTAGCCAACCTCACGGAGCCCGTGGTGCTCACTTTCCAGCAC
XM_005256248.1      GTGGTACAGAACACCAAAGTAGCCAACCTCACGGAGCCCGTGGTGCTCACTTTCCAGCAC
XM_005256245.1      GTGGTACAGAACACCAAAGTAGCCAACCTCACGGAGCCCGTGGTGCTCACTTTCCAGCAC
                    ************************************************** *********

HsCD00003670        CAGCTACAGCCGAAGAATGTGACTCTGCAATGTGTGTTCTGGGTTGAAGACCCCACATTG
XM_005256239.1      CAGCTACAGCCGAAGAATGTGACTCTGCAATGTGTGTTCTGGGTTGAAGACCCCACATTG
XM_005256249.1      CAGCTACAGCCGAAGAATGTGACTCTGCAATGTGTGTTCTGGGTTGAAGACCCCACATTG
XM_005256254.1      CAGCTACAGCCGAAGAATGTGACTCTGCAATGTGTGTTCTGGGTTGAAGACCCCACATTG
XM_005256238.1      CAGCTACAGCCGAAGAATGTGACTCTGCAATGTGTGTTCTGGGTTGAAGACCCCACATTG
XM_005256237.1      CAGCTACAGCCGAAGAATGTGACTCTGCAATGTGTGTTCTGGGTTGAAGACCCCACATTG
XM_005256255.1      CAGCTACAGCCGAAGAATGTGACTCTGCAATGTGTGTTCTGGGTTGAAGACCCCACATTG
XM_005256247.1      CAGCTACAGCCGAAGAATGTGACTCTGCAATGTGTGTTCTGGGTTGAAGACCCCACATTG
XM_005256252.1      CAGCTACAGCCGAAGAATGTGACTCTGCAATGTGTGTTCTGGGTTGAAGACCCCACATTG
XM_005256246.1      CAGCTACAGCCGAAGAATGTGACTCTGCAATGTGTGTTCTGGGTTGAAGACCCCACATTG
XM_005256248.1      CAGCTACAGCCGAAGAATGTGACTCTGCAATGTGTGTTCTGGGTTGAAGACCCCACATTG
XM_005256245.1      CAGCTACAGCCGAAGAATGTGACTCTGCAATGTGTGTTCTGGGTTGAAGACCCCACATTG
                    ************************************************************

HsCD00003670        AGCAGCCCGGGGCATTGGAGCAGTGCTGGGTGTGAGACCGTCAGGAGAGAAACCCAAACA
XM_005256239.1      AGCAGCCCGGGGCATTGGAGCAGTGCTGGGTGTGAGACCGTCAGGAGAGAAACCCAAACA
XM_005256249.1      AGCAGCCCGGGGCATTGGAGCAGTGCTGGGTGTGAGACCGTCAGGAGAGAAACCCAAACA
XM_005256254.1      AGCAGCCCGGGGCATTGGAGCAGTGCTGGGTGTGAGACCGTCAGGAGAGAAACCCAAACA
XM_005256238.1      AGCAGCCCGGGGCATTGGAGCAGTGCTGGGTGTGAGACCGTCAGGAGAGAAACCCAAACA
XM_005256237.1      AGCAGCCCGGGGCATTGGAGCAGTGCTGGGTGTGAGACCGTCAGGAGAGAAACCCAAACA
XM_005256255.1      AGCAGCCCGGGGCATTGGAGCAGTGCTGGGTGTGAGACCGTCAGGAGAGAAACCCAAACA
XM_005256247.1      AGCAGCCCGGGGCATTGGAGCAGTGCTGGGTGTGAGACCGTCAGGAGAGAAACCCAAACA
XM_005256252.1      AGCAGCCCGGGGCATTGGAGCAGTGCTGGGTGTGAGACCGTCAGGAGAGAAACCCAAACA
XM_005256246.1      AGCAGCCCGGGGCATTGGAGCAGTGCTGGGTGTGAGACCGTCAGGAGAGAAACCCAAACA
XM_005256248.1      AGCAGCCCGGGGCATTGGAGCAGTGCTGGGTGTGAGACCGTCAGGAGAGAAACCCAAACA
XM_005256245.1      AGCAGCCCGGGGCATTGGAGCAGTGCTGGGTGTGAGACCGTCAGGAGAGAAACCCAAACA
                    ************************************************************

HsCD00003670        TCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGCTGATGGTCTCCTCGGTGGAGGTG
XM_005256239.1      TCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGCTGATGGTCTCCTCGGTGGAGGTG
XM_005256249.1      TCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGCTGATGGTCTCCTCGGTGGAGGTG
XM_005256254.1      TCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGCTGATGGTCTCCTCGGTGGAGGTG
XM_005256238.1      TCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGCTGATGGTCTCCTCGGTGGAGGTG
XM_005256237.1      TCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGCTGATGGTCTCCTCGGTGGAGGTG
XM_005256255.1      TCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGCTGATGGTCTCCTCGGTGGAGGTG
XM_005256247.1      TCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGCTGATGGTCTCCTCGGTGGAGGTG
XM_005256252.1      TCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGCTGATGGTCTCCTCGGTGGAGGTG
XM_005256246.1      TCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGCTGATGGTCTCCTCGGTGGAGGTG
XM_005256248.1      TCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGCTGATGGTCTCCTCGGTGGAGGTG
XM_005256245.1      TCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGCTGATGGTCTCCTCGGTGGAGGTG
                    ************************************************************

HsCD00003670        GACGCCGTGCACAAGCACTACCTGAGCCTCCTCTCCTACGTGGGCTGTGTCGTCTCTGCC
XM_005256239.1      GACGCCGTGCACAAGCACTACCTGAGCCTCCTCTCCTACGTGGGCTGTGTCGTCTCTGCC
XM_005256249.1      GACGCCGTGCACAAGCACTACCTGAGCCTCCTCTCCTACGTGGGCTGTGTCGTCTCTGCC
XM_005256254.1      GACGCCGTGCACAAGCACTACCTGAGCCTCCTCTCCTACGTGGGCTGTGTCGTCTCTGCC
XM_005256238.1      GACGCCGTGCACAAGCACTACCTGAGCCTCCTCTCCTACGTGGGCTGTGTCGTCTCTGCC
XM_005256237.1      GACGCCGTGCACAAGCACTACCTGAGCCTCCTCTCCTACGTGGGCTGTGTCGTCTCTGCC
XM_005256255.1      GACGCCGTGCACAAGCACTACCTGAGCCTCCTCTCCTACGTGGGCTGTGTCGTCTCTGCC
XM_005256247.1      GACGCCGTGCACAAGCACTACCTGAGCCTCCTCTCCTACGTGGGCTGTGTCGTCTCTGCC
XM_005256252.1      GACGCCGTGCACAAGCACTACCTGAGCCTCCTCTCCTACGTGGGCTGTGTCGTCTCTGCC
XM_005256246.1      GACGCCGTGCACAAGCACTACCTGAGCCTCCTCTCCTACGTGGGCTGTGTCGTCTCTGCC
XM_005256248.1      GACGCCGTGCACAAGCACTACCTGAGCCTCCTCTCCTACGTGGGCTGTGTCGTCTCTGCC
XM_005256245.1      GACGCCGTGCACAAGCACTACCTGAGCCTCCTCTCCTACGTGGGCTGTGTCGTCTCTGCC
                    ************************************************************

HsCD00003670        CTGGCCTGCCTTGTCACCATTGCCGCCTACCTCTGCTCCAGGGTGCCCCTGCCGTGCAGG
XM_005256239.1      CTGGCCTGCCTTGTCACCATTGCCGCCTACCTCTGCTCCAGGGTGCCCCTGCCGTGCAGG
XM_005256249.1      CTGGCCTGCCTTGTCACCATTGCCGCCTACCTCTGCTCCAGGGTGCCCCTGCCGTGCAGG
XM_005256254.1      CTGGCCTGCCTTGTCACCATTGCCGCCTACCTCTGCTCCAGGGTGCCCCTGCCGTGCAGG
XM_005256238.1      CTGGCCTGCCTTGTCACCATTGCCGCCTACCTCTGCTCCAGGGTGCCCCTGCCGTGCAGG
XM_005256237.1      CTGGCCTGCCTTGTCACCATTGCCGCCTACCTCTGCTCCAGGGTGCCCCTGCCGTGCAGG
XM_005256255.1      CTGGCCTGCCTTGTCACCATTGCCGCCTACCTCTGCTCCAGG------------------
XM_005256247.1      CTGGCCTGCCTTGTCACCATTGCCGCCTACCTCTGCTCCAGGGTGCCCCTGCCGTGCAGG
XM_005256252.1      CTGGCCTGCCTTGTCACCATTGCCGCCTACCTCTGCTCCAGGGTGCCCCTGCCGTGCAGG
XM_005256246.1      CTGGCCTGCCTTGTCACCATTGCCGCCTACCTCTGCTCCAGGGTGCCCCTGCCGTGCAGG
XM_005256248.1      CTGGCCTGCCTTGTCACCATTGCCGCCTACCTCTGCTCCAGGGTGCCCCTGCCGTGCAGG
XM_005256245.1      CTGGCCTGCCTTGTCACCATTGCCGCCTACCTCTGCTCCAGGGTGCCCCTGCCGTGCAGG
                    ******************************************                  

HsCD00003670        AGGAAACCTCGGGACTACACCATCAAGGTGCACATGAACCTGCTGCTGGCCGTCTTCCTG
XM_005256239.1      AGGAAACCTCGGGACTACACCATCAAGGTGCACATGAACCTGCTGCTGGCCGTCTTCCTG
XM_005256249.1      AGGAAACCTCGGGACTACACCATCAAGGTGCACATGAACCTGCTGCTGGCCGTCTTCCTG
XM_005256254.1      AGGAAACCTCGGGACTACACCATCAAGGTGCACATGAACCTGCTGCTGGCCGTCTTCCTG
XM_005256238.1      AGGAAACCTCGGGACTACACCATCAAGGTGCACATGAACCTGCTGCTGGCCGTCTTCCTG
XM_005256237.1      AGGAAACCTCGGGACTACACCATCAAGGTGCACATGAACCTGCTGCTGGCCGTCTTCCTG
XM_005256255.1      AGGAAACCTCGGGACTACACCATCAAGGTGCACATGAACCTGCTGCTGGCCGTCTTCCTG
XM_005256247.1      AGGAAACCTCGGGACTACACCATCAAGGTGCACATGAACCTGCTGCTGGCCGTCTTCCTG
XM_005256252.1      AGGAAACCTCGGGACTACACCATCAAGGTGCACATGAACCTGCTGCTGGCCGTCTTCCTG
XM_005256246.1      AGGAAACCTCGGGACTACACCATCAAGGTGCACATGAACCTGCTGCTGGCCGTCTTCCTG
XM_005256248.1      AGGAAACCTCGGGACTACACCATCAAGGTGCACATGAACCTGCTGCTGGCCGTCTTCCTG
XM_005256245.1      AGGAAACCTCGGGACTACACCATCAAGGTGCACATGAACCTGCTGCTGGCCGTCTTCCTG
                    ************************************************************

HsCD00003670        CTGGACACGAGCTTCCTGCTCAGCGAGCCGGTGGCCCTGACAGGCTCTGAGGCTGGCTGC
XM_005256239.1      CTGGACACGAGCTTCCTGCTCAGCGAGCCGGTGGCCCTGACAGGCTCTGAGGCTGGCTGC
XM_005256249.1      CTGGACACGAGCTTCCTGCTCAGCGAGCCGGTGGCCCTGACAGGCTCTGAGGCTGGCTGC
XM_005256254.1      CTGGACACGAGCTTCCTGCTCAGCGAGCCGGTGGCCCTGACAGGCTCTGAGGCTGGCTGC
XM_005256238.1      CTGGACACGAGCTTCCTGCTCAGCGAGCCGGTGGCCCTGACAGGCTCTGAGGCTGGCTGC
XM_005256237.1      CTGGACACGAGCTTCCTGCTCAGCGAGCCGGTGGCCCTGACAGGCTCTGAGGCTGGCTGC
XM_005256255.1      CTGGACACGAGCTTCCTGCTCAGCGAGCCGGTGGCCCTGACAGGCTCTGAGGCTGGCTGC
XM_005256247.1      CTGGACACGAGCTTCCTGCTCAGCGAGCCGGTGGCCCTGACAGGCTCTGAGGCTGGCTGC
XM_005256252.1      CTGGACACGAGCTTCCTGCTCAGCGAGCCGGTGGCCCTGACAGGCTCTGAGGCTGGCTGC
XM_005256246.1      CTGGACACGAGCTTCCTGCTCAGCGAGCCGGTGGCCCTGACAGGCTCTGAGGCTGGCTGC
XM_005256248.1      CTGGACACGAGCTTCCTGCTCAGCGAGCCGGTGGCCCTGACAGGCTCTGAGGCTGGCTGC
XM_005256245.1      CTGGACACGAGCTTCCTGCTCAGCGAGCCGGTGGCCCTGACAGGCTCTGAGGCTGGCTGC
                    ************************************************************

HsCD00003670        CGAGCCAGTGCCATCTTCCTGCACTTCTCCCTGCTCACCTGCCTTTCCTGGATGGGCCTC
XM_005256239.1      CGAGCCAGTGCCATCTTCCTGCACTTCTCCCTGCTCACCTGCCTTTCCTGGATGGGCCTC
XM_005256249.1      CGAGCCAGTGCCATCTTCCTGCACTTCTCCCTGCTCACCTGCCTTTCCTGGATGGGCCTC
XM_005256254.1      CGAGCCAGTGCCATCTTCCTGCACTTCTCCCTGCTCACCTGCCTTTCCTGGATGGGCCTC
XM_005256238.1      CGAGCCAGTGCCATCTTCCTGCACTTCTCCCTGCTCACCTGCCTTTCCTGGATGGGCCTC
XM_005256237.1      CGAGCCAGTGCCATCTTCCTGCACTTCTCCCTGCTCACCTGCCTTTCCTGGATGGGCCTC
XM_005256255.1      CGAGCCAGTGCCATCTTCCTGCACTTCTCCCTGCTCACCTGCCTTTCCTGGATGGGCCTC
XM_005256247.1      CGAGCCAGTGCCATCTTCCTGCACTTCTCCCTGCTCACCTGCCTTTCCTGGATGGGCCTC
XM_005256252.1      CGAGCCAGTGCCATCTTCCTGCACTTCTCCCTGCTCACCTGCCTTTCCTGGATGGGCCTC
XM_005256246.1      CGAGCCAGTGCCATCTTCCTGCACTTCTCCCTGCTCACCTGCCTTTCCTGGATGGGCCTC
XM_005256248.1      CGAGCCAGTGCCATCTTCCTGCACTTCTCCCTGCTCACCTGCCTTTCCTGGATGGGCCTC
XM_005256245.1      CGAGCCAGTGCCATCTTCCTGCACTTCTCCCTGCTCACCTGCCTTTCCTGGATGGGCCTC
                    ************************************************************

HsCD00003670        GAGGGGTACAACCTCTACCGACTCGTGGTGGAGGTCTTTGGCACCTATGTCCCTGGCTAC
XM_005256239.1      GAGGGGTACAACCTCTACCGACTCGTGGTGGAGGTCTTTGGCACCTATGTCCCTGGCTAC
XM_005256249.1      GAGGGGTACAACCTCTACCGACTCGTGGTGGAGGTCTTTGGCACCTATGTCCCTGGCTAC
XM_005256254.1      GAGGGGTACAACCTCTACCGACTCGTGGTGGAGGTCTTTGGCACCTATGTCCCTGGCTAC
XM_005256238.1      GAGGGGTACAACCTCTACCGACTCGTGGTGGAGGTCTTTGGCACCTATGTCCCTGGCTAC
XM_005256237.1      GAGGGGTACAACCTCTACCGACTCGTGGTGGAGGTCTTTGGCACCTATGTCCCTGGCTAC
XM_005256255.1      GAGGGGTACAACCTCTACCGACTCGTGGTGGAGGTCTTTGGCACCTATGTCCCTGGCTAC
XM_005256247.1      GAGGGGTACAACCTCTACCGACTCGTGGTGGAGGTCTTTGGCACCTATGTCCCTGGCTAC
XM_005256252.1      GAGGGGTACAACCTCTACCGACTCGTGGTGGAGGTCTTTGGCACCTATGTCCCTGGCTAC
XM_005256246.1      GAGGGGTACAACCTCTACCGACTCGTGGTGGAGGTCTTTGGCACCTATGTCCCTGGCTAC
XM_005256248.1      GAGGGGTACAACCTCTACCGACTCGTGGTGGAGGTCTTTGGCACCTATGTCCCTGGCTAC
XM_005256245.1      GAGGGGTACAACCTCTACCGACTCGTGGTGGAGGTCTTTGGCACCTATGTCCCTGGCTAC
                    ************************************************************

HsCD00003670        CTACTCAAGCTGAGCGCCATGGGCTGGGGCTTCCCCATCTTTCTGGTGACGCTGGTGGCC
XM_005256239.1      CTACTCAAGCTGAGCGCCATGGGCTGGGGCTTCCCCATCTTTCTGGTGACGCTGGTGGCC
XM_005256249.1      CTACTCAAGCTGAGCGCCATGGGCTGGGGCTTCCCCATCTTTCTGGTGACGCTGGTGGCC
XM_005256254.1      CTACTCAAGCTGAGCGCCATGGGCTGGGGCTTCCCCATCTTTCTGGTGACGCTGGTGGCC
XM_005256238.1      CTACTCAAGCTGAGCGCCATGGGCTGGGGCTTCCCCATCTTTCTGGTGACGCTGGTGGCC
XM_005256237.1      CTACTCAAGCTGAGCGCCATGGGCTGGGGCTTCCCCATCTTTCTGGTGACGCTGGTGGCC
XM_005256255.1      CTACTCAAGCTGAGCGCCATGGGCTGGGGCTTCCCCATCTTTCTGGTGACGCTGGTGGCC
XM_005256247.1      CTACTCAAGCTGAGCGCCATGGGCTGGGGCTTCCCCATCTTTCTGGTGACGCTGGTGGCC
XM_005256252.1      CTACTCAAGCTGAGCGCCATGGGCTGGGGCTTCCCCATCTTTCTGGTGACGCTGGTGGCC
XM_005256246.1      CTACTCAAGCTGAGCGCCATGGGCTGGGGCTTCCCCATCTTTCTGGTGACGCTGGTGGCC
XM_005256248.1      CTACTCAAGCTGAGCGCCATGGGCTGGGGCTTCCCCATCTTTCTGGTGACGCTGGTGGCC
XM_005256245.1      CTACTCAAGCTGAGCGCCATGGGCTGGGGCTTCCCCATCTTTCTGGTGACGCTGGTGGCC
                    ************************************************************

HsCD00003670        CTGGTGGATGTGGACAACTATGGCCCCATCATCTTGGCTGTGCATAGGACTCCAGAGGGC
XM_005256239.1      CTGGTGGATGTGGACAACTATGGCCCCATCATCTTGGCTGTGCATAGGACTCCAGAGGGC
XM_005256249.1      CTGGTGGATGTGGACAACTATGGCCCCATCATCTTGGCTGTGCATAGGACTCCAGAGGGC
XM_005256254.1      CTGGTGGATGTGGACAACTATGGCCCCATCATCTTGGCTGTGCATAGGACTCCAGAGGGC
XM_005256238.1      CTGGTGGATGTGGACAACTATGGCCCCATCATCTTGGCTGTGCATAGGACTCCAGAGGGC
XM_005256237.1      CTGGTGGATGTGGACAACTATGGCCCCATCATCTTGGCTGTGCATAGGACTCCAGAGGGC
XM_005256255.1      CTGGTGGATGTGGACAACTATGGCCCCATCATCTTGGCTGTGCATAGGACTCCAGAGGGC
XM_005256247.1      CTGGTGGATGTGGACAACTATGGCCCCATCATCTTGGCTGTGCATAGGACTCCAGAGGGC
XM_005256252.1      CTGGTGGATGTGGACAACTATGGCCCCATCATCTTGGCTGTGCATAGGACTCCAGAGGGC
XM_005256246.1      CTGGTGGATGTGGACAACTATGGCCCCATCATCTTGGCTGTGCATAGGACTCCAGAGGGC
XM_005256248.1      CTGGTGGATGTGGACAACTATGGCCCCATCATCTTGGCTGTGCATAGGACTCCAGAGGGC
XM_005256245.1      CTGGTGGATGTGGACAACTATGGCCCCATCATCTTGGCTGTGCATAGGACTCCAGAGGGC
                    ************************************************************

HsCD00003670        GTCATCTACCCTTCCATGTGCTGGATCCGGGACTCCCTGGTCAGCTACATCACCAACCTG
XM_005256239.1      GTCATCTACCCTTCCATGTGCTGGATCCGGGACTCCCTGGTCAGCTACATCACCAACCTG
XM_005256249.1      GTCATCTACCCTTCCATGTGCTGGATCCGGGACTCCCTGGTCAGCTACATCACCAACCTG
XM_005256254.1      GTCATCTACCCTTCCATGTGCTGGATCCGGGACTCCCTGGTCAGCTACATCACCAACCTG
XM_005256238.1      GTCATCTACCCTTCCATGTGCTGGATCCGGGACTCCCTGGTCAGCTACATCACCAACCTG
XM_005256237.1      GTCATCTACCCTTCCATGTGCTGGATCCGGGACTCCCTGGTCAGCTACATCACCAACCTG
XM_005256255.1      GTCATCTACCCTTCCATGTGCTGGATCCGGGACTCCCTGGTCAGCTACATCACCAACCTG
XM_005256247.1      GTCATCTACCCTTCCATGTGCTGGATCCGGGACTCCCTGGTCAGCTACATCACCAACCTG
XM_005256252.1      GTCATCTACCCTTCCATGTGCTGGATCCGGGACTCCCTGGTCAGCTACATCACCAACCTG
XM_005256246.1      GTCATCTACCCTTCCATGTGCTGGATCCGGGACTCCCTGGTCAGCTACATCACCAACCTG
XM_005256248.1      GTCATCTACCCTTCCATGTGCTGGATCCGGGACTCCCTGGTCAGCTACATCACCAACCTG
XM_005256245.1      GTCATCTACCCTTCCATGTGCTGGATCCGGGACTCCCTGGTCAGCTACATCACCAACCTG
                    ************************************************************

HsCD00003670        GGCCTCTTCAGCCTGGTGTTTCTGTTCAACATGGCCATGCTAGCCACCATGGTGGTGCAG
XM_005256239.1      GGCCTCTTCAGCCTGGTGTTTCTGTTCAACATGGCCATGCTAGCCACCATGGTGGTGCAG
XM_005256249.1      GGCCTCTTCAGCCTGGTGTTTCTGTTCAACATGGCCATGCTAGCCACCATGGTGGTGCAG
XM_005256254.1      GGCCTCTTCAGCCTGGTGTTTCTGTTCAACATGGCCATGCTAGCCACCATGGTGGTGCAG
XM_005256238.1      GGCCTCTTCAGCCTGGTGTTTCTGTTCAACATGGCCATGCTAGCCACCATGGTGGTGCAG
XM_005256237.1      GGCCTCTTCAGCCTGGTGTTTCTGTTCAACATGGCCATGCTAGCCACCATGGTGGTGCAG
XM_005256255.1      GGCCTCTTCAGCCTGGTGTTTCTGTTCAACATGGCCATGCTAGCCACCATGGTGGTGCAG
XM_005256247.1      GGCCTCTTCAGCCTGGTGTTTCTGTTCAACATGGCCATGCTAGCCACCATGGTGGTGCAG
XM_005256252.1      GGCCTCTTCAGCCTGGTGTTTCTGTTCAACATGGCCATGCTAGCCACCATGGTGGTGCAG
XM_005256246.1      GGCCTCTTCAGCCTGGTGTTTCTGTTCAACATGGCCATGCTAGCCACCATGGTGGTGCAG
XM_005256248.1      GGCCTCTTCAGCCTGGTGTTTCTGTTCAACATGGCCATGCTAGCCACCATGGTGGTGCAG
XM_005256245.1      GGCCTCTTCAGCCTGGTGTTTCTGTTCAACATGGCCATGCTAGCCACCATGGTGGTGCAG
                    ************************************************************

HsCD00003670        ATCCTGCGGCTGCGCCCCCACACCCAAAAGTGGTCACATGTGCTGACACTGCTGGGCCTC
XM_005256239.1      ATCCTGCGGCTGCGCCCCCACACCCAAAAGTGGTCACATGTGCTGACACTGCTGGGCCTC
XM_005256249.1      ATCCTGCGGCTGCGCCCCCACACCCAAAAGTGGTCACATGTGCTGACACTGCTGGGCCTC
XM_005256254.1      ATCCTGCGGCTGCGCCCCCACACCCAAAAGTGGTCACATGTGCTGACACTGCTGGGCCTC
XM_005256238.1      ATCCTGCGGCTGCGCCCCCACACCCAAAAGTGGTCACATGTGCTGACACTGCTGGGCCTC
XM_005256237.1      ATCCTGCGGCTGCGCCCCCACACCCAAAAGTGGTCACATGTGCTGACACTGCTGGGCCTC
XM_005256255.1      ATCCTGCGGCTGCGCCCCCACACCCAAAAGTGGTCACATGTGCTGACACTGCTGGGCCTC
XM_005256247.1      ATCCTGCGGCTGCGCCCCCACACCCAAAAGTGGTCACATGTGCTGACACTGCTGGGCCTC
XM_005256252.1      ATCCTGCGGCTGCGCCCCCACACCCAAAAGTGGTCACATGTGCTGACACTGCTGGGCCTC
XM_005256246.1      ATCCTGCGGCTGCGCCCCCACACCCAAAAGTGGTCACATGTGCTGACACTGCTGGGCCTC
XM_005256248.1      ATCCTGCGGCTGCGCCCCCACACCCAAAAGTGGTCACATGTGCTGACACTGCTGGGCCTC
XM_005256245.1      ATCCTGCGGCTGCGCCCCCACACCCAAAAGTGGTCACATGTGCTGACACTGCTGGGCCTC
                    ************************************************************

HsCD00003670        AGCCTGGTCCTTGGCCTGCCCTGGGCCTTGATCTTCTTCTCCTTTGCTTCTGGCACCTTC
XM_005256239.1      AGCCTGGTCCTTGGCCTGCCCTGGGCCTTGATCTTCTTCTCCTTTGCTTCTGGCACCTTC
XM_005256249.1      AGCCTGGTCCTTGGCCTGCCCTGGGCCTTGATCTTCTTCTCCTTTGCTTCTGGCACCTTC
XM_005256254.1      AGCCTGGTCCTTGGCCTGCCCTGGGCCTTGATCTTCTTCTCCTTTGCTTCTGGCACCTTC
XM_005256238.1      AGCCTGGTCCTTGGCCTGCCCTGGGCCTTGATCTTCTTCTCCTTTGCTTCTGGCACCTTC
XM_005256237.1      AGCCTGGTCCTTGGCCTGCCCTGGGCCTTGATCTTCTTCTCCTTTGCTTCTGGCACCTTC
XM_005256255.1      AGCCTGGTCCTTGGCCTGCCCTGGGCCTTGATCTTCTTCTCCTTTGCTTCTGGCACCTTC
XM_005256247.1      AGCCTGGTCCTTGGCCTGCCCTGGGCCTTGATCTTCTTCTCCTTTGCTTCTGGCACCTTC
XM_005256252.1      AGCCTGGTCCTTGGCCTGCCCTGGGCCTTGATCTTCTTCTCCTTTGCTTCTGGCACCTTC
XM_005256246.1      AGCCTGGTCCTTGGCCTGCCCTGGGCCTTGATCTTCTTCTCCTTTGCTTCTGGCACCTTC
XM_005256248.1      AGCCTGGTCCTTGGCCTGCCCTGGGCCTTGATCTTCTTCTCCTTTGCTTCTGGCACCTTC
XM_005256245.1      AGCCTGGTCCTTGGCCTGCCCTGGGCCTTGATCTTCTTCTCCTTTGCTTCTGGCACCTTC
                    ************************************************************

HsCD00003670        CAGCTTGTCGTCCTCTACCTTTTCAGCATCATCACCTCCTTCCAAGGCTTCCTCATCTTC
XM_005256239.1      CAGCTTGTCGTCCTCTACCTTTTCAGCATCATCACCTCCTTCCAAGGCTTCCTCATCTTC
XM_005256249.1      CAGCTTGTCGTCCTCTACCTTTTCAGCATCATCACCTCCTTCCAAGGCTTCCTCATCTTC
XM_005256254.1      CAGCTTGTCGTCCTCTACCTTTTCAGCATCATCACCTCCTTCCAAGGCTTCCTCATCTTC
XM_005256238.1      CAGCTTGTCGTCCTCTACCTTTTCAGCATCATCACCTCCTTCCAAGGCTTCCTCATCTTC
XM_005256237.1      CAGCTTGTCGTCCTCTACCTTTTCAGCATCATCACCTCCTTCCAAGGCTTCCTCATCTTC
XM_005256255.1      CAGCTTGTCGTCCTCTACCTTTTCAGCATCATCACCTCCTTCCAAGGCTTCCTCATCTTC
XM_005256247.1      CAGCTTGTCGTCCTCTACCTTTTCAGCATCATCACCTCCTTCCAAGGCTTCCTCATCTTC
XM_005256252.1      CAGCTTGTCGTCCTCTACCTTTTCAGCATCATCACCTCCTTCCAAGGCTTCCTCATCTTC
XM_005256246.1      CAGCTTGTCGTCCTCTACCTTTTCAGCATCATCACCTCCTTCCAAGGCTTCCTCATCTTC
XM_005256248.1      CAGCTTGTCGTCCTCTACCTTTTCAGCATCATCACCTCCTTCCAAGGCTTCCTCATCTTC
XM_005256245.1      CAGCTTGTCGTCCTCTACCTTTTCAGCATCATCACCTCCTTCCAAGGCTTCCTCATCTTC
                    ************************************************************

HsCD00003670        ATCTGGTACTGGTCCATGCGGCTGCAGGCCCGGGGTGGCCCCTCCCCTCTGAAGAGCAAC
XM_005256239.1      ATCTGGTACTGGTCCATGCGGCTGCAGGCCCGGGGTGGCCCCTCCCCTCTGAAGAGCAAC
XM_005256249.1      ATCTGGTACTGGTCCATGCGGCTGCAGGCCCGGGGTGGCCCCTCCCCTCTGAAGAGCAAC
XM_005256254.1      ATCTGGTACTGGTCCATGCGGCTGCAGGCCCGGGGTGGCCCCTCCCCTCTGAAGAGCAAC
XM_005256238.1      ATCTGGTACTGGTCCATGCGGCTGCAGGCCCGGGGTGGCCCCTCCCCTCTGAAGAGCAAC
XM_005256237.1      ATCTGGTACTGGTCCATGCGGCTGCAGGCCCGGGGTGGCCCCTCCCCTCTGAAGAGCAAC
XM_005256255.1      ATCTGGTACTGGTCCATGCGGCTGCAGGCCCGGGGTGGCCCCTCCCCTCTGAAGAGCAAC
XM_005256247.1      ATCTGGTACTGGTCCATGCGGCTGCAGGCCCGGGGTGGCCCCTCCCCTCTGAAGAGCAAC
XM_005256252.1      ATCTGGTACTGGTCCATGCGGCTGCAGGCCCGGGGTGGCCCCTCCCCTCTGAAGAGCAAC
XM_005256246.1      ATCTGGTACTGGTCCATGCGGCTGCAGGCCCGGGGTGGCCCCTCCCCTCTGAAGAGCAAC
XM_005256248.1      ATCTGGTACTGGTCCATGCGGCTGCAGGCCCGGGGTGGCCCCTCCCCTCTGAAGAGCAAC
XM_005256245.1      ATCTGGTACTGGTCCATGCGGCTGCAGGCCCGGGGTGGCCCCTCCCCTCTGAAGAGCAAC
                    ************************************************************

HsCD00003670        TCAGACAGCGCCAGGCTCCCCATCAGCTCGGGCAGCACCTCGTCCAGCCGCATCTTG
XM_005256239.1      TCAGACAGCGCCAGGCTCCCCATCAGCTCGGGCAGCACCTCGTCCAGCCGCATCTAG
XM_005256249.1      TCAGACAGCGCCAGGCTCCCCATCAGCTCGGGCAGCACCTCGTCCAGCCGCATCTAG
XM_005256254.1      TCAGACAGCGCCAGGCTCCCCATCAGCTCGGGCAGCACCTCGTCCAGCCGCATCTAG
XM_005256238.1      TCAGACAGCGCCAGGCTCCCCATCAGCTCGGGCAGCACCTCGTCCAGCCGCATCTAG
XM_005256237.1      TCAGACAGCGCCAGGCTCCCCATCAGCTCGGGCAGCACCTCGTCCAGCCGCATCTAG
XM_005256255.1      TCAGACAGCGCCAGGCTCCCCATCAGCTCGGGCAGCACCTCGTCCAGCCGCATCTAG
XM_005256247.1      TCAGACAGCGCCAGGCTCCCCATCAGCTCGGGCAGCACCTCGTCCAGCCGCATCTAG
XM_005256252.1      TCAGACAGCGCCAGGCTCCCCATCAGCTCGGGCAGCACCTCGTCCAGCCGCATCTAG
XM_005256246.1      TCAGACAGCGCCAGGCTCCCCATCAGCTCGGGCAGCACCTCGTCCAGCCGCATCTAG
XM_005256248.1      TCAGACAGCGCCAGGCTCCCCATCAGCTCGGGCAGCACCTCGTCCAGCCGCATCTAG
XM_005256245.1      TCAGACAGCGCCAGGCTCCCCATCAGCTCGGGCAGCACCTCGTCCAGCCGCATCTAG
                    *******************************************************:*

Pathways

WikiPathway : GPCRs, Other

Protein

SMART domain : GPS : G-protein-coupled receptor proteolytic site domain
UniProt : Q9Y653
UniProt : B3KQN7
UniProt : B4DR54
UniProt : B3KQV4
HPRD : 06824

Clone

Cloning Information : 26459
HIP Master Clone ID : 56835
Original Clone ID : FLH026459.01L

Organism


TAX_ID : 9606
Species Specific ID: 9289

Genome

Chromosome : 16
Map Location : 16q13
Ensembl : ENSG00000205336

Reagents

Labome : GPR56-antibody