DNASU Plasmid Repository • 480.965.5697 | Email

PTPN6 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PTPN6
Gene Name:  protein tyrosine phosphatase, non-receptor type 6
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH013949.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00003675

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1794nts         Open reading frame : 1 to 1794
Reference Sequence Alignment

ATGCTGTCCCGTGGGTGGTTTCACCGAGACCTCAGTGGGCTGGATGCAGAGACCCTGCTC
AAGGGCCGAGGTGTCCACGGTAGCTTCCTGGCTCGGCCCAGTCGCAAGAACCAGGGTGAC
TTCTCGCTCTCCGTCAGGGTGGGGGATCAGGTGACCCATATTCGGATCCAGAACTCAGGG
GATTTCTATGACCTGTATGGAGGGGAGAAGTTTGCGACTCTGACAGAGCTGGTGGAGTAC
TACACTCAGCAGCAGGGTGTCCTGCAGGACCGCGACGGCACCATCATCCACCTCAAGTAC
CCGCTGAACTGCTCCGATCCCACTAGTGAGAGGTGGTACCATGGCCACATGTCTGGCGGG
CAGGCAGAGACGCTGCTGCAGGCCAAGGGCGAGCCCTGGACGTTTCTTGTGCGTGAGAGC
CTCAGCCAGCCTGGAGACTTCGTGCTTTCTGTGCTCAGTGACCAGCCCAAGGCTGGCCCA
GGCTCCCCGCTCAGGGTCACCCACATCAAGGTCATGTGCGAGGGTGGACGCTACACAGTG
GGTGGTTTGGAGACCTTCGACAGCCTCACGGACCTGGTGGAGCATTTCAAGAAGACGGGG
ATTGAGGAGGCCTCAGGCGCCTTTGTCTACCTGCGGCAGCCGTACTATGCCACGAGGGTG
AATGCGGCTGACATTGAGAACCGAGTGTTGGAACTGAACAAGAAGCAGGAGTCCGAGGAT
ACAGCCAAGGCTGGCTTCTGGGAGGAGTTTGAGAGTTTGCAGAAGCAGGAGGTGAAGAAC
TTGCACCAGCGTCTGGAAGGGCAGCGGCCAGAGAACAAGGGCAAGAACCGCTACAAGAAC
ATTCTCCCCTTTGACCACAGCCGAGTGATCCTGCAGGGACGGGACAGTAACATCCCCGGG
TCCGACTACATCAATGCCAACTACATCAAGAACCAGCTGCTAGGCCCTGATGAGAACGCT
AAGACCTACATCGCCAGCCAGGGCTGTCTGGAGGCCACGGTCAATGACTTCTGGCAGATG
GCGTGGCAGGAGAACAGCCGTGTCATCGTCATGACCACCCGAGAGGTGGAGAAAGGCCGG
AACAAATGCGTCCCATACTGGCCCGAGGTGGGCATGCAGCGTGCTTATGGGCCCTACTCT
GTGACCAACTGCGGGGAGCATGACACAACCGAATACAAACTCCGTACCTTACAGGTCTCC
CCGCTGGACAATGGAGACCTGATTCGGGAGATCTGGCATTACCAGTACCTGAGCTGGCCC
GACCATGGGGTCCCCAGTGAGCCTGGGGGTGTCCTCAGCTTCCTGGACCAGATCAACCAG
CGGCAGGAAAGTCTGCCTCACGCAGGGCCCATCATCGTGCACTGCAGCGCCGGCATCGGC
CGCACAGGCACCATCATTGTCATCGACATGCTCATGGAGAACATCTCCACCAAGGGCCTG
GACTGTGACATTGACATCCAGAAGACCATCCAGATGGTGCGGGCGCAGCGCTCGGGCATG
GTGCAGACGGAGGCGCAGTACAAGTTCATCTACGTGGCCATCGCCCAGTTCATTGAAACC
ACTAAGAAGAAGCTGGAGGTCCTGCAGTCGCAGAAGGGCCAGGAGTCGGAGTACGGGAAC
ATCACCTATCCCCCAGCCATGAAGAATGCCCATGCCAAGGCCTCCCGCACCTCGTCCAAA
CACAAGGAGGATGTGTATGAGAACCTGCACACTAAGAACAAGAGGGAGGAGAAAGTGAAG
AAGCAGCGGTCAGCAGACAAGGAGAAGAGCAAGGGTTCCCTCAAGAGGAAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1938
Start on reference sequence 145
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PTPN6
Symbol Nomenclature : PTPN6
SYNONYM : HCP; HCPH; HPTP1C; PTP-1C; SH-PTP1; SHP-1; SHP-1L; SHP1
Designation : hematopoietic cell phosphatase|hematopoietic cell protein-tyrosine phosphatase|protein-tyrosine phosphatase 1C|protein-tyrosine phosphatase SHP-1|tyrosine-protein phosphatase non-receptor type 6
Full Nomenclature : protein tyrosine phosphatase, non-receptor type 6
GENEID : 5777
GI : 60652920
GenBank Accession : AY892238
HGNC : 9658
MIM : 176883
Vega : OTTHUMG00000168518
Target GenBank: BC007667

 

Reference Sequence Alignment

  

HsCD00003675      ATGCTGTCCCGTGGGTGGTTTCACCGAGACCTCAGTGGGCTGGATGCAGAGACCCTGCTC
NM_080548.4       ATGCTGTCCCGTGGGTGGTTTCACCGAGACCTCAGTGGGCTGGATGCAGAGACCCTGCTC
NM_002831.5       ------ATGGTGAGGTGGTTTCACCGAGACCTCAGTGGGCTGGATGCAGAGACCCTGCTC
NM_080549.3       ------ATGGTGAGGTGGTTTCACCGAGACCTCAGTGGGCTGGATGCAGAGACCCTGCTC
                        :     .***********************************************

HsCD00003675      AAGGGCCGAGGTGTCCACGGTAGCTTCCTGGCTCGGCCCAGTCGCAAGAACCAGGGTGAC
NM_080548.4       AAGGGCCGAGGTGTCCACGGTAGCTTCCTGGCTCGGCCCAGTCGCAAGAACCAGGGTGAC
NM_002831.5       AAGGGCCGAGGTGTCCACGGTAGCTTCCTGGCTCGGCCCAGTCGCAAGAACCAGGGTGAC
NM_080549.3       AAGGGCCGAGGTGTCCACGGTAGCTTCCTGGCTCGGCCCAGTCGCAAGAACCAGGGTGAC
                  ************************************************************

HsCD00003675      TTCTCGCTCTCCGTCAGGGTGGGGGATCAGGTGACCCATATTCGGATCCAGAACTCAGGG
NM_080548.4       TTCTCGCTCTCCGTCAGGGTGGGGGATCAGGTGACCCATATTCGGATCCAGAACTCAGGG
NM_002831.5       TTCTCGCTCTCCGTCAGGGTGGGGGATCAGGTGACCCATATTCGGATCCAGAACTCAGGG
NM_080549.3       TTCTCGCTCTCCGTCAGGGTGGGGGATCAGGTGACCCATATTCGGATCCAGAACTCAGGG
                  ************************************************************

HsCD00003675      GATTTCTATGACCTGTATGGAGGGGAGAAGTTTGCGACTCTGACAGAGCTGGTGGAGTAC
NM_080548.4       GATTTCTATGACCTGTATGGAGGGGAGAAGTTTGCGACTCTGACAGAGCTGGTGGAGTAC
NM_002831.5       GATTTCTATGACCTGTATGGAGGGGAGAAGTTTGCGACTCTGACAGAGCTGGTGGAGTAC
NM_080549.3       GATTTCTATGACCTGTATGGAGGGGAGAAGTTTGCGACTCTGACAGAGCTGGTGGAGTAC
                  ************************************************************

HsCD00003675      TACACTCAGCAGCAGGGTGTCCTGCAGGACCGCGACGGCACCATCATCCACCTCAAGTAC
NM_080548.4       TACACTCAGCAGCAGGGTGTCCTGCAGGACCGCGACGGCACCATCATCCACCTCAAGTAC
NM_002831.5       TACACTCAGCAGCAGGGTGTCCTGCAGGACCGCGACGGCACCATCATCCACCTCAAGTAC
NM_080549.3       TACACTCAGCAGCAGGGTGTCCTGCAGGACCGCGACGGCACCATCATCCACCTCAAGTAC
                  ************************************************************

HsCD00003675      CCGCTGAACTGCTCCGATCCCACTAGTGAGAGGTGGTACCATGGCCACATGTCTGGCGGG
NM_080548.4       CCGCTGAACTGCTCCGATCCCACTAGTGAGAGGTGGTACCATGGCCACATGTCTGGCGGG
NM_002831.5       CCGCTGAACTGCTCCGATCCCACTAGTGAGAGGTGGTACCATGGCCACATGTCTGGCGGG
NM_080549.3       CCGCTGAACTGCTCCGATCCCACTAGTGAGAGGTGGTACCATGGCCACATGTCTGGCGGG
                  ************************************************************

HsCD00003675      CAGGCAGAGACGCTGCTGCAGGCCAAGGGCGAGCCCTGGACGTTTCTTGTGCGTGAGAGC
NM_080548.4       CAGGCAGAGACGCTGCTGCAGGCCAAGGGCGAGCCCTGGACGTTTCTTGTGCGTGAGAGC
NM_002831.5       CAGGCAGAGACGCTGCTGCAGGCCAAGGGCGAGCCCTGGACGTTTCTTGTGCGTGAGAGC
NM_080549.3       CAGGCAGAGACGCTGCTGCAGGCCAAGGGCGAGCCCTGGACGTTTCTTGTGCGTGAGAGC
                  ************************************************************

HsCD00003675      CTCAGCCAGCCTGGAGACTTCGTGCTTTCTGTGCTCAGTGACCAGCCCAAGGCTGGCCCA
NM_080548.4       CTCAGCCAGCCTGGAGACTTCGTGCTTTCTGTGCTCAGTGACCAGCCCAAGGCTGGCCCA
NM_002831.5       CTCAGCCAGCCTGGAGACTTCGTGCTTTCTGTGCTCAGTGACCAGCCCAAGGCTGGCCCA
NM_080549.3       CTCAGCCAGCCTGGAGACTTCGTGCTTTCTGTGCTCAGTGACCAGCCCAAGGCTGGCCCA
                  ************************************************************

HsCD00003675      GGCTCCCCGCTCAGGGTCACCCACATCAAGGTCATGTGCGAGGGTGGACGCTACACAGTG
NM_080548.4       GGCTCCCCGCTCAGGGTCACCCACATCAAGGTCATGTGCGAGGGTGGACGCTACACAGTG
NM_002831.5       GGCTCCCCGCTCAGGGTCACCCACATCAAGGTCATGTGCGAGGGTGGACGCTACACAGTG
NM_080549.3       GGCTCCCCGCTCAGGGTCACCCACATCAAGGTCATGTGCGAGGGTGGACGCTACACAGTG
                  ************************************************************

HsCD00003675      GGTGGTTTGGAGACCTTCGACAGCCTCACGGACCTGGTGGAGCATTTCAAGAAGACGGGG
NM_080548.4       GGTGGTTTGGAGACCTTCGACAGCCTCACGGACCTGGTGGAGCATTTCAAGAAGACGGGG
NM_002831.5       GGTGGTTTGGAGACCTTCGACAGCCTCACGGACCTGGTGGAGCATTTCAAGAAGACGGGG
NM_080549.3       GGTGGTTTGGAGACCTTCGACAGCCTCACGGACCTGGTGGAGCATTTCAAGAAGACGGGG
                  ************************************************************

HsCD00003675      ATTGAGGAGGCCTCAGGCGCCTTTGTCTACCTGCGGCAGCCGTACTATGCCACGAGGGTG
NM_080548.4       ATTGAGGAGGCCTCAGGCGCCTTTGTCTACCTGCGGCAGCCGTACTATGCCACGAGGGTG
NM_002831.5       ATTGAGGAGGCCTCAGGCGCCTTTGTCTACCTGCGGCAGCCGTACTATGCCACGAGGGTG
NM_080549.3       ATTGAGGAGGCCTCAGGCGCCTTTGTCTACCTGCGGCAGCCGTACTATGCCACGAGGGTG
                  ************************************************************

HsCD00003675      AATGCGGCTGACATTGAGAACCGAGTGTTGGAACTGAACAAGAAGCAGGAGTCCGAGGAT
NM_080548.4       AATGCGGCTGACATTGAGAACCGAGTGTTGGAACTGAACAAGAAGCAGGAGTCCGAGGAT
NM_002831.5       AATGCGGCTGACATTGAGAACCGAGTGTTGGAACTGAACAAGAAGCAGGAGTCCGAGGAT
NM_080549.3       AATGCGGCTGACATTGAGAACCGAGTGTTGGAACTGAACAAGAAGCAGGAGTCCGAGGAT
                  ************************************************************

HsCD00003675      ACAGCCAAGGCTGGCTTCTGGGAGGAGTTTGAGAGTTTGCAGAAGCAGGAGGTGAAGAAC
NM_080548.4       ACAGCCAAGGCTGGCTTCTGGGAGGAGTTTGAGAGTTTGCAGAAGCAGGAGGTGAAGAAC
NM_002831.5       ACAGCCAAGGCTGGCTTCTGGGAGGAGTTTGAGAGTTTGCAGAAGCAGGAGGTGAAGAAC
NM_080549.3       ACAGCCAAGGCTGGCTTCTGGGAGGAGTTTGAGAGTTTGCAGAAGCAGGAGGTGAAGAAC
                  ************************************************************

HsCD00003675      TTGCACCAGCGTCTGGAAGGGCAGCGGCCAGAGAACAAGGGCAAGAACCGCTACAAGAAC
NM_080548.4       TTGCACCAGCGTCTGGAAGGGCAGCGGCCAGAGAACAAGGGCAAGAACCGCTACAAGAAC
NM_002831.5       TTGCACCAGCGTCTGGAAGGGCAGCGGCCAGAGAACAAGGGCAAGAACCGCTACAAGAAC
NM_080549.3       TTGCACCAGCGTCTGGAAGGGCAGCGGCCAGAGAACAAGGGCAAGAACCGCTACAAGAAC
                  ************************************************************

HsCD00003675      ATTCTCCCCTTTGACCACAGCCGAGTGATCCTGCAGGGACGGGACAGTAACATCCCCGGG
NM_080548.4       ATTCTCCCCTTTGACCACAGCCGAGTGATCCTGCAGGGACGGGACAGTAACATCCCCGGG
NM_002831.5       ATTCTCCCCTTTGACCACAGCCGAGTGATCCTGCAGGGACGGGACAGTAACATCCCCGGG
NM_080549.3       ATTCTCCCCTTTGACCACAGCCGAGTGATCCTGCAGGGACGGGACAGTAACATCCCCGGG
                  ************************************************************

HsCD00003675      TCCGACTACATCAATGCCAACTACATCAAGAACCAGCTGCTAGGCCCTGATGAGAACGCT
NM_080548.4       TCCGACTACATCAATGCCAACTACATCAAGAACCAGCTGCTAGGCCCTGATGAGAACGCT
NM_002831.5       TCCGACTACATCAATGCCAACTACATCAAGAACCAGCTGCTAGGCCCTGATGAGAACGCT
NM_080549.3       TCCGACTACATCAATGCCAACTACATCAAGAACCAGCTGCTAGGCCCTGATGAGAACGCT
                  ************************************************************

HsCD00003675      AAGACCTACATCGCCAGCCAGGGCTGTCTGGAGGCCACGGTCAATGACTTCTGGCAGATG
NM_080548.4       AAGACCTACATCGCCAGCCAGGGCTGTCTGGAGGCCACGGTCAATGACTTCTGGCAGATG
NM_002831.5       AAGACCTACATCGCCAGCCAGGGCTGTCTGGAGGCCACGGTCAATGACTTCTGGCAGATG
NM_080549.3       AAGACCTACATCGCCAGCCAGGGCTGTCTGGAGGCCACGGTCAATGACTTCTGGCAGATG
                  ************************************************************

HsCD00003675      GCGTGGCAGGAGAACAGCCGTGTCATCGTCATGACCACCCGAGAGGTGGAGAAAGGCCGG
NM_080548.4       GCGTGGCAGGAGAACAGCCGTGTCATCGTCATGACCACCCGAGAGGTGGAGAAAGGCCGG
NM_002831.5       GCGTGGCAGGAGAACAGCCGTGTCATCGTCATGACCACCCGAGAGGTGGAGAAAGGCCGG
NM_080549.3       GCGTGGCAGGAGAACAGCCGTGTCATCGTCATGACCACCCGAGAGGTGGAGAAAGGCCGG
                  ************************************************************

HsCD00003675      AACAAATGCGTCCCATACTGGCCCGAGGTGGGCATGCAGCGTGCTTATGGGCCCTACTCT
NM_080548.4       AACAAATGCGTCCCATACTGGCCCGAGGTGGGCATGCAGCGTGCTTATGGGCCCTACTCT
NM_002831.5       AACAAATGCGTCCCATACTGGCCCGAGGTGGGCATGCAGCGTGCTTATGGGCCCTACTCT
NM_080549.3       AACAAATGCGTCCCATACTGGCCCGAGGTGGGCATGCAGCGTGCTTATGGGCCCTACTCT
                  ************************************************************

HsCD00003675      GTGACCAACTGCGGGGAGCATGACACAACCGAATACAAACTCCGTACCTTACAGGTCTCC
NM_080548.4       GTGACCAACTGCGGGGAGCATGACACAACCGAATACAAACTCCGTACCTTACAGGTCTCC
NM_002831.5       GTGACCAACTGCGGGGAGCATGACACAACCGAATACAAACTCCGTACCTTACAGGTCTCC
NM_080549.3       GTGACCAACTGCGGGGAGCATGACACAACCGAATACAAACTCCGTACCTTACAGGTCTCC
                  ************************************************************

HsCD00003675      CCGCTGGACAATGGAGACCTGATTCGGGAGATCTGGCATTACCAGTACCTGAGCTGGCCC
NM_080548.4       CCGCTGGACAATGGAGACCTGATTCGGGAGATCTGGCATTACCAGTACCTGAGCTGGCCC
NM_002831.5       CCGCTGGACAATGGAGACCTGATTCGGGAGATCTGGCATTACCAGTACCTGAGCTGGCCC
NM_080549.3       CCGCTGGACAATGGAGACCTGATTCGGGAGATCTGGCATTACCAGTACCTGAGCTGGCCC
                  ************************************************************

HsCD00003675      GACCATGGGGTCCCCAGTGAGCCTGGGGGTGTCCTCAGCTTCCTGGACCAGATCAACCAG
NM_080548.4       GACCATGGGGTCCCCAGTGAGCCTGGGGGTGTCCTCAGCTTCCTGGACCAGATCAACCAG
NM_002831.5       GACCATGGGGTCCCCAGTGAGCCTGGGGGTGTCCTCAGCTTCCTGGACCAGATCAACCAG
NM_080549.3       GACCATGGGGTCCCCAGTGAGCCTGGGGGTGTCCTCAGCTTCCTGGACCAGATCAACCAG
                  ************************************************************

HsCD00003675      CGGCAGGAAAGTCTGCCTCACGCAGGGCCCATCATCGTGCACTGCAGCGCCGGCATCGGC
NM_080548.4       CGGCAGGAAAGTCTGCCTCACGCAGGGCCCATCATCGTGCACTGCAGCGCCGGCATCGGC
NM_002831.5       CGGCAGGAAAGTCTGCCTCACGCAGGGCCCATCATCGTGCACTGCAGCGCCGGCATCGGC
NM_080549.3       CGGCAGGAAAGTCTGCCTCACGCAGGGCCCATCATCGTGCACTGCAGCGCCGGCATCGGC
                  ************************************************************

HsCD00003675      CGCACAGGCACCATCATTGTCATCGACATGCTCATGGAGAACATCTCCACCAAGGGCCTG
NM_080548.4       CGCACAGGCACCATCATTGTCATCGACATGCTCATGGAGAACATCTCCACCAAGGGCCTG
NM_002831.5       CGCACAGGCACCATCATTGTCATCGACATGCTCATGGAGAACATCTCCACCAAGGGCCTG
NM_080549.3       CGCACAGGCACCATCATTGTCATCGACATGCTCATGGAGAACATCTCCACCAAGGGCCTG
                  ************************************************************

HsCD00003675      GACTGTGACATTGACATCCAGAAGACCATCCAGATGGTGCGGGCGCAGCGCTCGGGCATG
NM_080548.4       GACTGTGACATTGACATCCAGAAGACCATCCAGATGGTGCGGGCGCAGCGCTCGGGCATG
NM_002831.5       GACTGTGACATTGACATCCAGAAGACCATCCAGATGGTGCGGGCGCAGCGCTCGGGCATG
NM_080549.3       GACTGTGACATTGACATCCAGAAGACCATCCAGATGGTGCGGGCGCAGCGCTCGGGCATG
                  ************************************************************

HsCD00003675      GTGCAGACGGAGGCGCAGTACAAGTTCATCTACGTGGCCATCGCCCAGTTCATTGAAACC
NM_080548.4       GTGCAGACGGAGGCGCAGTACAAGTTCATCTACGTGGCCATCGCCCAGTTCATTGAAACC
NM_002831.5       GTGCAGACGGAGGCGCAGTACAAGTTCATCTACGTGGCCATCGCCCAGTTCATTGAAACC
NM_080549.3       GTGCAGACGGAGGCGCAGTACAAGTTCATCTACGTGGCCATCGCCCAGTTCATTGAAACC
                  ************************************************************

HsCD00003675      ACTAAGAAGAAGCTGGAGGTCCTGCAGTCGCAGAAGGGCCAGGAGTCGGAGTACGGGAAC
NM_080548.4       ACTAAGAAGAAGCTGGAGGTCCTGCAGTCGCAGAAGGGCCAGGAGTCGGAGTACGGGAAC
NM_002831.5       ACTAAGAAGAAGCTGGAGGTCCTGCAGTCGCAGAAGGGCCAGGAGTCGGAGTACGGGAAC
NM_080549.3       ACTAAGAAGAAGCTGGAGGTCCTGCAGTCGCAGAAGGGCCAGGAGTCGGAGTACGGGAAC
                  ************************************************************

HsCD00003675      ATCACCTATCCCCCAGCCATGAAGAATGCCCATGCCAAGGCCTCCCGCACCTCGTCCAAA
NM_080548.4       ATCACCTATCCCCCAGCCATGAAGAATGCCCATGCCAAGGCCTCCCGCACCTCGTCCAAA
NM_002831.5       ATCACCTATCCCCCAGCCATGAAGAATGCCCATGCCAAGGCCTCCCGCACCTCGTCCAAA
NM_080549.3       ATCACCTATCCCCCAGCCATGAAGAATGCCCATGCCAAGGCCTCCCGCACCTCGTCCAAG
                  ***********************************************************.

HsCD00003675      CACAAGGAGGATGTGTATGAGAACCTGCACACTAAGAACAAGAGGGAGGAGAAAGTGAAG
NM_080548.4       CACAAGGAGGATGTGTATGAGAACCTGCACACTAAGAACAAGAGGGAGGAGAAAGTGAAG
NM_002831.5       CACAAGGAGGATGTGTATGAGAACCTGCACACTAAGAACAAGAGGGAGGAGAAAGTGAAG
NM_080549.3       AGCTTGGAGTCTAGTGCAGGGACCGTGGCTGCGTCACCTGTGAGACGGGGTGGCCAGAGG
                  ..*::**** .*.   .:*.**.* ** . .* :.... .:***. .**. ... :**.*

HsCD00003675      AAGCAGCGGTCAGCAG--------------------------------------------
NM_080548.4       AAGCAGCGGTCAGCAG--------------------------------------------
NM_002831.5       AAGCAGCGGTCAGCAG--------------------------------------------
NM_080549.3       GGACTGCCAGTGCCGGGTCCCCCTGTGCTGTCTCCTGACCTGCACCAACTGCCTGTACTT
                  ...*:** .  . *.*                                            

HsCD00003675      ------------------------ACAAGGAGAAGAGCAAGGGTTCCCTCAAGAGGAAGT
NM_080548.4       ------------------------ACAAGGAGAAGAGCAAGGGTTCCCTCAAGAGGAAGT
NM_002831.5       ------------------------ACAAGGAGAAGAGCAAGGGTTCCCTCAAGAGGAAGT
NM_080549.3       GCCCCCCTGCACCCGGCTGCAGACACAAGGAGGATGTGTATGAGAACCTGCACACTAAGA
                                          ********.* .  :* *. :.*** .* *  ***:

HsCD00003675      TG-------------------
NM_080548.4       GA-------------------
NM_002831.5       GA-------------------
NM_080549.3       ACAAGAGGGAGGAGAAAGTGA
                                       

Pathways

NCI : BCR signaling pathway
NCI : CXCR4-mediated signaling events
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EPO signaling pathway
NCI : IL4-mediated signaling events
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
Panther : B cell activation
Panther : FGF signaling pathway
Panther : Interferon-gamma signaling pathway
Reactome : Adaptive Immune System
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Costimulation by the CD28 family
Reactome : Cytokine Signaling in Immune system
Reactome : Growth hormone receptor signaling
Reactome : Hemostasis
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : Interferon gamma signaling
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : PD-1 signaling
Reactome : PECAM1 interactions
Reactome : Platelet homeostasis
Reactome : Platelet sensitization by LDL
Reactome : Regulation of IFNA signaling
Reactome : Regulation of IFNG signaling
Reactome : Regulation of KIT signaling
Reactome : Signal Transduction
Reactome : Signal regulatory protein (SIRP) family interactions
Reactome : Signaling by Interleukins
Reactome : Signaling by SCF-KIT
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : Kit receptor signaling pathway
WikiPathway : Regulation of toll-like receptor signaling pathway

Clone

Cloning Information : 13949
HIP Master Clone ID : 28148
Original Clone ID : FLH013949.01L

Organism


TAX_ID : 9606
Species Specific ID: 5777

Genome

Chromosome : 12
Map Location : 12p13
Ensembl : ENSG00000111679

Reagents

Labome : SHP-1-antibody