DNASU Plasmid Repository • 480.965.5697 | Email

prfA (F. tularensis Schu 4 ) in pBY011_GFP-NH3_CN (GFP-tagged yeast expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  prfA
Gene Name:  peptide chain release factor 1
Sequence             
Original Clone ID: FLH235253.01X
Keyword: None
Species: Francisella tularensis Schu 4
Type: cDNA
Vector Name: pBY011_GFP-NH3_CN               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
FtCD00036777

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1086nts         Open reading frame : 1 to 1086

ATGAAAGATTCTATTAAAGCAAAATTGCAAAGTTTGATAGAAAGGCATGAGGAAGTTAGT
GCCTTATTAAGTGAGGCAGGAATTATCTCTGATCAAAATAAGTTCAGAGATTTATCAAAA
GAATACTCTCATCTTGAGCCGATTGTAAAGGCGTTTAAAAAATATACACAAGCTTTAGAA
GACAAACAAGCTGCTTATGAAATGCTTAATGAAAAAGATGCTGAGCTTGTAGAGATGGCA
AAAGAAGAATTAAAGTTGGCAAATGAAGCTATTGAGAAACTGGAGAGTGAATTACAAATA
TTTCTTTTACCTCGTGATCCTAATGATGATGCTAACGTTTTCTTGGAGATTCGTGCAGGA
ACTGGCGGTGATGAGGCTTCGATATTTTCAGGTGATTTGTTTAAGATGTATTCAAAATAT
GCTGAGCAAAGAGGCTGGAAGATTGAAGTAATATCGGCTAGTGAAGGCGAGCATGGCGGT
TATAAGGAAATCATCTCAAGAATATATGGCGATGGTGTATATTCACAACTAAAATTTGAA
TCTGGTGCTCACCGAGTACAAAGAGTTCCTGCTACAGAGTCGCAGGGTAGAATCCATACT
TCAGCGTGTACTGTTGCGGTTATGCCTGAAGCAGATGAGGTTGAGGGGATTGATATTAAT
CCTGCAGATATCAAAGTGGATACTTTTAGAGCATCGGGTGCGGGAGGACAGCACGTCAAC
AAGACTGATTCAGCGATTAGGATTACCCATATCCCAACAGGTGTTGTTGTCGAATGCCAA
GATCAAAGATCACAGCACAAAAACCGTGCAGCTGCAATGTCGATGCTTAAATCAAAGCTG
TTACAAGCAGAAATTGATAAACAGCAAAAAGAGCAATCTGATACACGTAAGAGCCTGGTC
GGTAGCGGTGATAGATCAGAGAGAATTAGAACTTATAATTACCCGCAAGGTAGAGTTACC
GATCATCGTATAAATTTAACTCTTTATAAGCTTGATGAGGTCATGGAAGGTAGTCTAGAT
AGTATTATCCAACCACTAGTTCTAGAACATCAGGCGGATCTTTTAGCAACCATGTCTGAT
GAGTAG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1086
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  yeast    Marker:  URA
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pBY011_GFP-NH3_CN

pBY011_GFP-NH3_CN in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Yeast expression vector, adds N-terminal fluorescent (GFP) tag; amp resistance; recombinational cloning.
Comments: This vector appears to be derived from pBY011-D123
Size (bp): 7920
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), fluorescent marker, recombinational cloning, with tag/fusion/marker, yeast expression, yeast shuttle
Author Name:
Publications: None
Vector Map:         Vector Sequence:
Sequence: Not Available

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori origin of replication 5118 5800
bacterial origin ColE1 ori ColE1 origin of replication 0 0
negative selection marker ccdB ccdB death cassette ONLY in Non-Recombined (NO INSERT) form 6381 6590
promoter Gal 1-10 Gal 1-10 promoter (yeast) 0 0
recombination site attR1 att recombination site 7901 7917
recombination site attB2 att recombination (half?) site 0 0
recombination site attB1 att recombination (half?) site 0 0
recombination site attR2 att recombination site 6215 6230
selectable marker CmR chlorampenicol resistance gene ONLY In Non-Recombined (NO INSERT) form 7028 7684
selectable marker AmpR ampicillin resistance gene 4361 5020
selectable marker URA3 URA3 nutritional marker 0 0
tag GFP Green fluorescent protein coding region 0 0
yeast ARS ARS1 ARS1 replication sequence (yeast) 0 0
yeast centromere CEN4 CEN4 yeast centromeric sequence 0 0

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Reagents

Gene

Target GenBank: YP_169234

 

Protein

SMART domain : PCRF :
UniProt : Q5NIA8

Clone

Cloning Information : 235253
HIP Master Clone ID : 131744
Original Clone ID : FLH235253.01X

Organism


Species Specific ID: FTT0168

Reagents

Labome : prfA-cDNA