DNASU Plasmid Repository • 480.965.5697 | Email

PASK (Homo sapiens) in pSGX6 (His and Smt3-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PASK
Gene Name:  PAS domain containing serine/threonine kinase
Sequence             
Original Clone ID: 9501a14SPt2p1
Keyword: full-length cds
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX6               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: Linker not verified.
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00369577

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 360nts         Open reading frame : 51 to 410

AGGATAACGATATTATTGAGGCTCACAGAGAACAGATTGGTGGATCCCTTTCCTCACCTC
TGCTTCCGGCCCCTGTGTGCAACCCTAACAAGGCCATCTTCACGGTGGATGCCAAGACCA
CAGAGATCCTGGTTGCTAACGACAAAGCTTGCGGGCTCCTGGGGTACAGCAGCCAGGACC
TGATTGGCCAGAAGCTCACGCAGTTCTTTCTGAGGTCAGATTCTGATGTGGTGGAGGCCC
TCAGCGAGGAGCACATGGAGGCCGACGGCCACGCTGCGGTGGTGTTTGGCACGGTGGTGG
ACATCATCAGCCGTAGTGGGGAGAAGATTCCAGTGTCTGTGTGGATGAAGAGGATGCGGC
AGGAGCGCCGCCTATGCTGCGTGGTGGTCCTGGAGCCCGTGGAGAGGTAAGGGTGAGCTC
CGTCGACGGATGGAGTGAAAGAGATGCGCTATTACGAAAAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ACAGAGAACAGATTGGTGGATCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-9501a
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX6

pSGX6 in advanced viewed

Synonyms: pSGX-6, pSGX6_SP
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds N-terminal 6xHis and smt tags, cleavage site, also expresses lambda phosphatase; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen. N-terminal 6xHis-tag followed by smt3 fusion protein. Smt3 fusion cloned into NheI and BamHI sites. Additionally, this vector expresses the lambda phosphatase gene. TOPO adaptation at BamHI and SacI sites. TOPO version of PS.
Size (bp): 6316
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
TOPO recognition site TOPO Topo cloning iste 5435 5444
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
promoter T7 T7 promoter 4984 5003
repressor protein gene LacI lacIq cds 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag SUMO Smt3/SUMO tag 5140 5424
tag His 6xHis tag 5083 5100
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 6250 6296

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PASK
Symbol Nomenclature : PASK
SYNONYM : PASKIN; STK37
Designation : PAS domain-containing serine/threonine-protein kinase|per-arnt-sim (PAS) domain kinase
Full Nomenclature : PAS domain containing serine/threonine kinase
GENEID : 23178
GI : 14583077
GenBank Accession : AF387103
HGNC : 17270
MIM : 607505
Vega : OTTHUMG00000133392
Target GenBank: AF387103

 

Protein

SMART domain : PAS : PAS domain
Structural Annotation Wiki : TOPSAN
UniProt : Q96RG2
UniProt : Q05BE4
HPRD : 06328

Clone

Cloning Information : 483820
HIP Master Clone ID : 401548
Original Clone ID : 9501a14SPt2p1

Experimental

TargetTrack - Experimental data : NYSGXRC-9501a

Organism


TAX_ID : 9606
Species Specific ID: 23178

Genome

Chromosome : 2
Map Location : 2q37.3
Ensembl : ENSG00000115687

Reagents

Labome : PASK-antibody