DNASU Plasmid Repository • 480.965.2857 | Email

AgaP_AGAP006171 (A. gambiae ) in pSGX4 (His and Smt3-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AgaP_AGAP006171
Gene Name:  AGAP006171-PA
Sequence             
Original Clone ID: 8886z2BSt2p1
Keyword: full-length cds
Species: Anopheles gambiae
Type: cDNA
Vector Name: pSGX4               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: Linker not verified.
Mutation/
Discrepancy :
No / No
Publications: PMID: 18058037
Title: Structural genomics of protein phosphatases
Authors: PSI
New York SGX Research Center for Structural Genomics
AgCD00369932

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 909nts         Open reading frame : 51 to 959

AGGATAACGATATTATTGAGGCTCACAGAGAACAGATTGGTGGATCCCTTGGCGCGTATC
TGAGCGAACCGTTAACCACGAAAGATTCTAGTGACGAGTCAAATGAATTTCTGGCCTCCG
GTTCGAGCTCTATGCAGGGGTGGCGTATTAGTCAAGAGGATGCACATAACTGCATCTTGA
ATTTCGACGATCAGTGTTCATTTTTCGCTGTGTACGACGGACACGGCGGTGCGGAAGTTG
CCCAATATTGCTCCCTTCATCTCCCAACTTTTCTGAAGACAGTCGAAGCATACGGGCGCA
AAGAGTTCGAAAAAGCTTTAAAGGAGGCGTTTTTGGGATTCGATGCCACCCTTCTGCAGG
AAAAAGTAATAGAAGAGCTCAAAGTGCTGTCGGGCGATAGCGCAGGTTCTGACGCTGAAC
CTGGCAAGGATAGTGGTTGTACGGCGGTTGTCGCCTTACTGCACGGGAAAGACTTGTATG
TAGCAAACGCTGGAGATTCACGGTGCGTGGTTTGTAGAAATGGCAAAGCGCTTGAGATGT
CCTTTGACCATAAGCCCGAAGATACTGTCGAATACCAGCGAATTGAGAAAGCCGGTGGCC
GTGTGACACTGGATGGTCGCGTAAACGGGGGACTCAATTTATCGCGTGCAATCGGCGACC
ACGGTTATAAAATGAACAAGAGCCTGCCGGCGGAAGAGCAAATGATTTCTGCTTTGCCAG
ATATCGAAAAAATAACCGTTGGGCCTGAAGACGAGTTCATGGTGCTTGCCTGCGATGGCA
TTTGGAATTTTATGACGAGTGAACAGGTCGTTCAATTTGTACAGGAACGCATCAACAAAC
CGGGTATGAAGCTGTCAAAAATTTGTGAGGAACTGTTCGATCATTGCCTCGCACCCCACA
CCCGGGGAGACGGCACTGGTTGTGATAATATGACAGCGATTATCGTGCAGTTTAAATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ACAGAGAACAGATTGGTGGATCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-8886z
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX4

pSGX4 in advanced viewed

Synonyms: pSGX-4, pSGX4_BS
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promotor, adds N-terminal 6xHis and smt-3 tags, cleavage site; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen. N-terminal 6xHis-tag followed by smt3 fusion protein. Smt3 fusion cloned into NheI and BamHI sites. TOPO adaptation at BamHI and XhoI sites.
Size (bp): 5611
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
TOPO recognition site TOPO TOPO cloning site 5435 5444
bacterial origin ColE ColE1 bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4984 5003
protease cleavage site ULP site ULP cleavage site (recognizes the tertiary structure of SUMO) 5140 5140
repressor protein gene LacI lacI cds 3515 4351
ribosome binding site RBS ribosome binding site (RBS) 5062 5068
selectable marker KanR kanamycin resistance gene 563 1375
tag Smt3 Smt3 tag 5140 5424
tag His 6xHis tag 5083 5100
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 termination sequence 5539 5585

 


Cloning Information: 493939
GI: 158295480
GenBank Accession: XM_316230
HIP Master Clone ID: 407619
Labome: AgaP_AGAP006171-cDNA
Original Clone ID: 8886z2BSt2p1
SMART domain: PP2Cc : Serine/threonine phosphatases, family 2C, catalytic domain
SMART domain: PP2C_SIG : Sigma factor PP2C-like phosphatases
Structural Annotation Wiki: TOPSAN
TAIR ID: XP_316230
TargetTrack - Experimental data: NYSGXRC-8886z
UniProt: Q7PP01
Species Specific ID: 1276838
Target GenBank: None