DNASU Plasmid Repository • 480.965.2857 | Email

PPM1B (Homo sapiens) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PPM1B
Gene Name:  protein phosphatase, Mg2+/Mn2+ dependent, 1B
Sequence             
Original Clone ID: 8702a4BCt2p1
Keyword: full-length cds
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: Linker not verified. Actual 5' flanking sequence provided below. High number of silent and/or missense mutations in CDS. Reference sequence corrected.
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 18058037
Title: Structural genomics of protein phosphatases
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00370014

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 915nts         Open reading frame : 6 to 920
Reference Sequence Alignment

CCCTTGGTGCATTTTTGGATAAACCCAAAACTGAAAAACATAATGCTCATGGTGCTGGGA
ATGGTTTACGTTATGGCCTGAGCAGCATGCAAGGATGGAGAGTGGAAATGGAAGATGCAC
ACACAGCTGTTGTAGGTATTCCTCACGGCTTGGAAGACTGGTCATTTTTTGCAGTTTATG
ATGGTCATGCTGGATCCCGAGTGGCAAATTACTGCTCAACACATTTATTAGAACACATCA
CTACTAACGAAGACTTTAGGGCAGCTGGAAAATCAGGATCTGCTCTTGAGCTTTCAGTGG
AAAATGTTAAGAATGGTATCAGAACTGGATTTTTGAAAATTGATGAATACATGCGTAACT
TTTCAGACCTCAGAAACGGGATGGACAGGAGTGGTTCAACTGCAGTGGGAGTTATGATTT
CACCTAAGCATATCTACTTTATCAACTGTGGTGATTCACGTGCTGTTCTGTATAGGAATG
GACAAGTCTGCTTTTCTACCCAGGATCACAAACCTTGCAATCCAAGGGAAAAGGAGCGAA
TCCAAAATGCAGGAGGCAGCGTGATGATACAACGTGTTAATGGTTCATTAGCAGTATCTC
GTGCTCTGGGAGACTATGATTACAAGTGTGTTGATGGCAAGGGCCCAACAGAACAACTTG
TTTCTCCAGAGCCTGAGGTTTATGAAATTTTAAGAGCAGAAGAGGATGAATTTATCATCT
TGGCTTGTGATGGGATCTGGGATGTTATGAGTAATGAGGAGCTCTGTGAATATGTTAAAT
CTAGGCTTGAGGTATCTGATGACCTGGAAAATGTGTGCAATTGGGTAGTGGACACTTGTT
TACACAAGGGAAGTCGAGATAACATGAGTATTGTACTAGTTTGCTTTTCAAATGAAGGGC
ATCATCACCATCACCACTGATCCGAATTCGAGCTCCGTCGACAAGC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-8702a
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PPM1B
Symbol Nomenclature : PPM1B
SYNONYM : PP2C-beta-X; PP2CB; PP2CBETA; PPC2BETAX
Designation : PP2C-beta|protein phosphatase 1B|protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform|protein phosphatase 2C isoform beta|protein phosphatase 2C-like protein
Full Nomenclature : protein phosphatase, Mg2+/Mn2+ dependent, 1B
GENEID : 5495
GI : 29558022
GenBank Accession : NM_177968
HGNC : 9276
MIM : 603770
Vega : OTTHUMG00000128757
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00370014        CCCTTGGTGCATTTTTGGATAAACCCAAAACTGAAAAACATAATGCTCATGGTGCTGGGA
NM_001033556.1      --ATGGGTGCATTTTTGGATAAACCCAAAACTGAAAAACATAATGCTCATGGTGCTGGGA
NM_001033557.1      --ATGGGTGCATTTTTGGATAAACCCAAAACTGAAAAACATAATGCTCATGGTGCTGGGA
NM_002706.4         --ATGGGTGCATTTTTGGATAAACCCAAAACTGAAAAACATAATGCTCATGGTGCTGGGA
NM_177968.2         --ATGGGTGCATTTTTGGATAAACCCAAAACTGAAAAACATAATGCTCATGGTGCTGGGA
                      .* *******************************************************

HsCD00370014        ATGGTTTACGTTATGGCCTGAGCAGCATGCAAGGATGGAGAGTGGAAATGGAAGATGCAC
NM_001033556.1      ATGGTTTACGTTATGGCCTGAGCAGCATGCAAGGATGGAGAGTGGAAATGGAAGATGCAC
NM_001033557.1      ATGGTTTACGTTATGGCCTGAGCAGCATGCAAGGATGGAGAGTGGAAATGGAAGATGCAC
NM_002706.4         ATGGTTTACGTTATGGCCTGAGCAGCATGCAAGGATGGAGAGTGGAAATGGAAGATGCAC
NM_177968.2         ATGGTTTACGTTATGGCCTGAGCAGCATGCAAGGATGGAGAGTGGAAATGGAAGATGCAC
                    ************************************************************

HsCD00370014        ACACAGCTGTTGTAGGTATTCCTCACGGCTTGGAAGACTGGTCATTTTTTGCAGTTTATG
NM_001033556.1      ACACAGCTGTTGTAGGTATTCCTCACGGCTTGGAAGACTGGTCATTTTTTGCAGTTTATG
NM_001033557.1      ACACAGCTGTTGTAGGTATTCCTCACGGCTTGGAAGACTGGTCATTTTTTGCAGTTTATG
NM_002706.4         ACACAGCTGTTGTAGGTATTCCTCACGGCTTGGAAGACTGGTCATTTTTTGCAGTTTATG
NM_177968.2         ACACAGCTGTTGTAGGTATTCCTCACGGCTTGGAAGACTGGTCATTTTTTGCAGTTTATG
                    ************************************************************

HsCD00370014        ATGGTCATGCTGGATCCCGAGTGGCAAATTACTGCTCAACACATTTATTAGAACACATCA
NM_001033556.1      ATGGTCATGCTGGATCCCGAGTGGCAAATTACTGCTCAACACATTTATTAGAACACATCA
NM_001033557.1      ATGGTCATGCTGGATCCCGAGTGGCAAATTACTGCTCAACACATTTATTAGAACACATCA
NM_002706.4         ATGGTCATGCTGGATCCCGAGTGGCAAATTACTGCTCAACACATTTATTAGAACACATCA
NM_177968.2         ATGGTCATGCTGGATCCCGAGTGGCAAATTACTGCTCAACACATTTATTAGAACACATCA
                    ************************************************************

HsCD00370014        CTACTAACGAAGACTTTAGGGCAGCTGGAAAATCAGGATCTGCTCTTGAGCTTTCAGTGG
NM_001033556.1      CTACTAACGAAGACTTTAGGGCAGCTGGAAAATCAGGATCTGCTCTTGAGCTTTCAGTGG
NM_001033557.1      CTACTAACGAAGACTTTAGGGCAGCTGGAAAATCAGGATCTGCTCTTGAGCTTTCAGTGG
NM_002706.4         CTACTAACGAAGACTTTAGGGCAGCTGGAAAATCAGGATCTGCTCTTGAGCTTTCAGTGG
NM_177968.2         CTACTAACGAAGACTTTAGGGCAGCTGGAAAATCAGGATCTGCTCTTGAGCTTTCAGTGG
                    ************************************************************

HsCD00370014        AAAATGTTAAGAATGGTATCAGAACTGGATTTTTGAAAATTGATGAATACATGCGTAACT
NM_001033556.1      AAAATGTTAAGAATGGTATCAGAACTGGATTTTTGAAAATTGATGAATACATGCGTAACT
NM_001033557.1      AAAATGTTAAGAATGGTATCAGAACTGGATTTTTGAAAATTGATGAATACATGCGTAACT
NM_002706.4         AAAATGTTAAGAATGGTATCAGAACTGGATTTTTGAAAATTGATGAATACATGCGTAACT
NM_177968.2         AAAATGTTAAGAATGGTATCAGAACTGGATTTTTGAAAATTGATGAATACATGCGTAACT
                    ************************************************************

HsCD00370014        TTTCAGACCTCAGAAACGGGATGGACAGGAGTGGTTCAACTGCAGTGGGAGTTATGATTT
NM_001033556.1      TTTCAGACCTCAGAAACGGGATGGACAGGAGTGGTTCAACTGCAGTGGGAGTTATGATTT
NM_001033557.1      TTTCAGACCTCAGAAACGGGATGGACAGGAGTGGTTCAACTGCAGTGGGAGTTATGATTT
NM_002706.4         TTTCAGACCTCAGAAACGGGATGGACAGGAGTGGTTCAACTGCAGTGGGAGTTATGATTT
NM_177968.2         TTTCAGACCTCAGAAACGGGATGGACAGGAGTGGTTCAACTGCAGTGGGAGTTATGATTT
                    ************************************************************

HsCD00370014        CACCTAAGCATATCTACTTTATCAACTGTGGTGATTCACGTGCTGTTCTGTATAGGAATG
NM_001033556.1      CACCTAAGCATATCTACTTTATCAACTGTGGTGATTCACGTGCTGTTCTGTATAGGAATG
NM_001033557.1      CACCTAAGCATATCTACTTTATCAACTGTGGTGATTCACGTGCTGTTCTGTATAGGAATG
NM_002706.4         CACCTAAGCATATCTACTTTATCAACTGTGGTGATTCACGTGCTGTTCTGTATAGGAATG
NM_177968.2         CACCTAAGCATATCTACTTTATCAACTGTGGTGATTCACGTGCTGTTCTGTATAGGAATG
                    ************************************************************

HsCD00370014        GACAAGTCTGCTTTTCTACCCAGGATCACAAACCTTGCAATCCAAGGGAAAAGGAGCGAA
NM_001033556.1      GACAAGTCTGCTTTTCTACCCAGGATCACAAACCTTGCAATCCAAGGGAAAAGGAGCGAA
NM_001033557.1      GACAAGTCTGCTTTTCTACCCAGGATCACAAACCTTGCAATCCAAGGGAAAAGGAGCGAA
NM_002706.4         GACAAGTCTGCTTTTCTACCCAGGATCACAAACCTTGCAATCCAAGGGAAAAGGAGCGAA
NM_177968.2         GACAAGTCTGCTTTTCTACCCAGGATCACAAACCTTGCAATCCAAGGGAAAAGGAGCGAA
                    ************************************************************

HsCD00370014        TCCAAAATGCAGGAGGCAGCGTGATGATACAACGTGTTAATGGTTCATTAGCAGTATCTC
NM_001033556.1      TCCAAAATGCAGGAGGCAGCGTGATGATACAACGTGTTAATGGTTCATTAGCAGTATCTC
NM_001033557.1      TCCAAAATGCAGGAGGCAGCGTGATGATACAACGTGTTAATGGTTCATTAGCAGTATCTC
NM_002706.4         TCCAAAATGCAGGAGGCAGCGTGATGATACAACGTGTTAATGGTTCATTAGCAGTATCTC
NM_177968.2         TCCAAAATGCAGGAGGCAGCGTGATGATACAACGTGTTAATGGTTCATTAGCAGTATCTC
                    ************************************************************

HsCD00370014        GTGCTCTGGGAGACTATGATTACAAGTGTGTTGATGGCAAGGGCCCAACAGAACAACTTG
NM_001033556.1      GTGCTCTGGGGGACTATGATTACAAGTGTGTTGATGGCAAGGGCCCAACAGAACAACTTG
NM_001033557.1      GTGCTCTGGGGGACTATGATTACAAGTGTGTTGATGGCAAGGGCCCAACAGAACAACTTG
NM_002706.4         GTGCTCTGGGGGACTATGATTACAAGTGTGTTGATGGCAAGGGCCCAACAGAACAACTTG
NM_177968.2         GTGCTCTGGGGGACTATGATTACAAGTGTGTTGATGGCAAGGGCCCAACAGAACAACTTG
                    **********.*************************************************

HsCD00370014        TTTCTCCAGAGCCTGAGGTTTATGAAATTTTAAGAGCAGAAGAGGATGAATTTATCATCT
NM_001033556.1      TTTCTCCAGAGCCTGAGGTTTATGAAATTTTAAGAGCAGAAGAGGATGAATTTATCATCT
NM_001033557.1      TTTCTCCAGAGCCTGAGGTTTATGAAATTTTAAGAGCAGAAGAGGATGAATTTATCATCT
NM_002706.4         TTTCTCCAGAGCCTGAGGTTTATGAAATTTTAAGAGCAGAAGAGGATGAATTTATCATCT
NM_177968.2         TTTCTCCAGAGCCTGAGGTTTATGAAATTTTAAGAGCAGAAGAGGATGAATTTATCATCT
                    ************************************************************

HsCD00370014        TGGCTTGTGATGGGATCTGGGATGTTATGAGTAATGAGGAGCTCTGTGAATATGTTAAAT
NM_001033556.1      TGGCTTGTGATGGGATCTGGGATGTTATGAGTAATGAGGAGCTCTGTGAATATGTTAAAT
NM_001033557.1      TGGCTTGTGATGGGATCTGGGATGTTATGAGTAATGAGGAGCTCTGTGAATATGTTAAAT
NM_002706.4         TGGCTTGTGATGGGATCTGGGATGTTATGAGTAATGAGGAGCTCTGTGAATATGTTAAAT
NM_177968.2         TGGCTTGTGATGGGATCTGGGATGTTATGAGTAATGAGGAGCTCTGTGAATATGTTAAAT
                    ************************************************************

HsCD00370014        CTAGGCTTGAGGTATCTGATGACCTGGAAAATGTGTGCAATTGGGTAGTGGACACTTGTT
NM_001033556.1      CTAGGCTTGAGGTATCTGATGACCTGGAAAATGTGTGCAATTGGGTAGTGGACACTTGTT
NM_001033557.1      CTAGGCTTGAGGTATCTGATGACCTGGAAAATGTGTGCAATTGGGTAGTGGACACTTGTT
NM_002706.4         CTAGGCTTGAGGTATCTGATGACCTGGAAAATGTGTGCAATTGGGTAGTGGACACTTGTT
NM_177968.2         CTAGGCTTGAGGTATCTGATGACCTGGAAAATGTGTGCAATTGGGTAGTGGACACTTGTT
                    ************************************************************

HsCD00370014        TACACAAGGGAAGTCGAGATAACATGAGTATTGTACTAGTTTGCTTTTCAAATGAAGGGC
NM_001033556.1      TACACAAGGGAAGTCGAGATAACATGAGTATTGTACTAGTTTGCTTTTCAAATGCTCCCA
NM_001033557.1      TACACAAGGGAAGTCGAGATAACATGAGTATTGTACTAGTTTGCTTTTCAAATGCTCCCA
NM_002706.4         TACACAAGGGAAGTCGAGATAACATGAGTATTGTACTAGTTTGCTTTTCAAATGCTCCCA
NM_177968.2         TACACAAGGGAAGTCGAGATAACATGAGTATTGTACTAGTTTGCTTTTCAAATGCTCCCA
                    ******************************************************.:   .

HsCD00370014        ATCATCACCATCACCACTGATCCGAATTCGAGCTCCGTCGACAAGC--------------
NM_001033556.1      AGGTCTCAGATGAAGCGGTGAAAAAAGATTCAGAGTTGGATAAGCACTTGGAATCACGGG
NM_001033557.1      AGGTCTCAGATGAAGCGGTGAAAAAAGATTCAGAGTTGGATAAGCACTTGGAATCACGGG
NM_002706.4         AGGTCTCAGATGAAGCGGTGAAAAAAGATTCAGAGTTGGATAAGCACTTGGAATCACGGG
NM_177968.2         AGGTCTCAGATGAAGCGGTGAAAAAAGATTCAGAGTTGGATAAGCACTTGGAATCACGGG
                    *  :  .. ** *. .   .:...** :  .. :     .:.*. .              

HsCD00370014        ------------------------------------------------------------
NM_001033556.1      TTGAAGGTAAGACAAATGCTTTTTAA----------------------------------
NM_001033557.1      TTGAAGAGATTATGGAGAAGTCTGGCGAGGAAGGAATGCCTGATCTTGCCCATGTCATGC
NM_002706.4         TTGAAGAGATTATGGAGAAGTCTGGCGAGGAAGGAATGCCTGATCTTGCCCATGTCATGC
NM_177968.2         TTGAAGAGATTATGGAGAAGTCTGGCGAGGAAGGAATGCCTGATCTTGCCCATGTCATGC
                                                                                

HsCD00370014        ------------------------------------------------------------
NM_001033556.1      ------------------------------------------------------------
NM_001033557.1      GCATCTTGTCTGCAGAAAATATCCCAAATTTGCCTCCTGGGGGAGGTCTTGCTGGCAAGC
NM_002706.4         GCATCTTGTCTGCAGAAAATATCCCAAATTTGCCTCCTGGGGGAGGTCTTGCTGGCAAGC
NM_177968.2         GCATCTTGTCTGCAGAAAATATCCCAAATTTGCCTCCTGGGGGAGGTCTTGCTGGCAAGC
                                                                                

HsCD00370014        ------------------------------------------------------------
NM_001033556.1      ------------------------------------------------------------
NM_001033557.1      GTAATGTTATTGAAGCTGTTTATAGTAGACTGAATCCACATAGAGAAAGTGATGGGCAGA
NM_002706.4         GTAATGTTATTGAAGCTGTTTATAGTAGACTGAATCCACATAGAGAAAGTGATGGGGCCT
NM_177968.2         GTAATGTTATTGAAGCTGTTTATAGTAGACTGAATCCACATAGAGAAAGTGATGGGGGTG
                                                                                

HsCD00370014        ------------------------------------------------------------
NM_001033556.1      ------------------------------------------------------------
NM_001033557.1      AATGA-------------------------------------------------------
NM_002706.4         CCGATGAAGCAGAGGAAAGTGGATCACAGGGAAAATTGGTGGAAGCTCTCAGGCAAATGA
NM_177968.2         CTGGAGATCTAGAAGACCCATGGTAG----------------------------------
                                                                                

HsCD00370014        ------------------------------------------------------------
NM_001033556.1      ------------------------------------------------------------
NM_001033557.1      ------------------------------------------------------------
NM_002706.4         GAATTAATCATAGGGGAAACTACCGACAACTTCTGGAGGAGATGCTGACTAGTTACAGGC
NM_177968.2         ------------------------------------------------------------
                                                                                

HsCD00370014        ------------------------------------------------------------
NM_001033556.1      ------------------------------------------------------------
NM_001033557.1      ------------------------------------------------------------
NM_002706.4         TAGCTAAAGTAGAGGGAGAAGAAAGCCCTGCTGAACCAGCTGCCACAGCTACTTCTTCGA
NM_177968.2         ------------------------------------------------------------
                                                                                

HsCD00370014        ------------------------------------------------------------
NM_001033556.1      ------------------------------------------------------------
NM_001033557.1      ------------------------------------------------------------
NM_002706.4         ACAGTGATGCTGGAAACCCAGTGACAATGCAGGAAAGCCATACTGAATCAGAAAGTGGTC
NM_177968.2         ------------------------------------------------------------
                                                                                

HsCD00370014        ------------------------------------------------------------
NM_001033556.1      ------------------------------------------------------------
NM_001033557.1      ------------------------------------------------------------
NM_002706.4         TTGCTGAATTAGACAGCTCTAATGAAGATGCAGGGACAAAGATGAGTGGTGAAAAAATAT
NM_177968.2         ------------------------------------------------------------
                                                                                

HsCD00370014        --
NM_001033556.1      --
NM_001033557.1      --
NM_002706.4         GA
NM_177968.2         --
                      

Pathways

Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Cytokine Signaling in Immune system
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Interferon Signaling
WikiPathway : MAPK signaling pathway

Protein

PDB - Structural Annotation : 2P8E
SMART domain : PP2Cc : Serine/threonine phosphatases, family 2C, catalytic domain
Structural Annotation Wiki : TOPSAN
UniProt : Q4J6C2
UniProt : Q658R4
UniProt : Q4J6C1
UniProt : O75688
HPRD : 04796
Protein Structure Viewer

FirstGlance in Jmol
PDB ID

Style



Color





Clone

Cloning Information : 494154
HIP Master Clone ID : 407834
Original Clone ID : 8702a4BCt2p1

Experimental

Structural Biology Knowledgebase : SBKB (2P8E)
TargetTrack - Experimental data : NYSGXRC-8702a

Organism


TAX_ID : 9606
Species Specific ID: 5495

Genome

Chromosome : 2
Map Location : 2p21
Ensembl : ENSG00000138032

Reagents

Labome : PPM1B-antibody