DNASU Plasmid Repository • 480.965.2857 | Email

DR_0370 (Deinococcus radiodurans) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  DR_0370
Gene Name:  hypothetical protein
Sequence             
Original Clone ID: 10093b1BCt3p1
Keyword: full-length cds
Species: Deinococcus radiodurans
Type: cDNA
Vector Name: pSGX3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: Linker not verified. Actual 5' flanking sequence provided below.
Mutation/
Discrepancy :
No / No
Publications: PMID: 17908300
Title: X-ray structures of two proteins belonging to Pfam DUF178 revealed unexpected structural similarity to the DUF191 Pfam family
Authors: PSI
New York SGX Research Center for Structural Genomics
DrCD00370146

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 897nts         Open reading frame : 39 to 935

TTTGTTAACTTTAAGAAGGAGATATACATATGTCCCTTACCAACCATCACCCATCATCTA
CTGGCCCTCAACACCCCTACCGCGCGGGGTGGATTCATTTCACCAACGTCGCGCCCATTC
TGGATTCGCTGGAGCTGCCGCCGGGCGTTACAGCCATCACTGGCGTGCCCACCCAGATGA
ACGCGGCGCTGCTTTCGGGCGAGGTGGACATCGCCAACGTCAGCGCGGTGGAGTTCATCC
GGCACGCCGACACGCTCGCGGCCCTGCCCGACTTCAGCGTGGCGGTGCTGGGGCCGGTGT
ACTCGGTCAATCTTTTTCACACCTGCCCGCTGCCGGAGCTGCGCCGGGTGGCCTTGACCT
CGCAAAGTGCCATGAGCGTGGCGCTGCTGGAAGTGCTGCTGCGGCAAAAGGGCCTCTCGC
CTGTGCTAGAGCGTGCCGAGGGCACCGCCGAGTCGCTGTTGGCCGCCGGGTATGACGGCG
TGCTCCGCATCGGCGACGACGCCTTGCGCGAATGGTACGGGGTGGTCGGTCCCCTGACGC
CGGAGCGCACCATGACCAGCCTGCCGCACACGGGGCGTGGCATTACCGTCACCGACCTCG
CGCAGGAGTGGTTCGACCTCACCGGCCACCCCTTCACCTTCGCCGTGTGGGCCTATCGCA
AGGACAATCCGCCGCCCGCCGCCCTTCTTCAGGCCATGCGCGAGGCGCGGCGCCGGGGCA
TCGGGCACCTCGCGGAAGTGTCGCAGCGGCACGCTGAAAAATTGGGCCTGCCCGAACGGG
TGGTGCAGCACTACCTCTGGAACTTCCGCTACCACCTCGAAGCGCCCGACCGCCTCGGCC
TGCGCGAATTCGCCGACCTCGCGGTGCCGGGGCACGCGGAACTGACCTTCGGAGCGCGTG
AGGAAGCAGAAGGGCATCATCACCATCACCACTGATCCGAATTCGAGCTCCGTCGACAAG
CTTGCGGCCGCACTCGAGCACCACCA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-10093b
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : DR_0370
GENEID : 1797707
Locus Tag : DR_0370
GI : 15805399
GenBank Accession : Q9RXE3
Target GenBank: None

 

Protein

PDB - Structural Annotation : 2I6E
Structural Annotation Wiki : TOPSAN
UniProt : Q9RXE3
Protein Structure Viewer

FirstGlance in Jmol
PDB ID

Style



Color





Clone

Cloning Information : 494521
HIP Master Clone ID : 408201
Original Clone ID : 10093b1BCt3p1

Experimental

Structural Biology Knowledgebase : SBKB (2I6E)
TargetTrack - Experimental data : NYSGXRC-10093b

Organism


TAX_ID : 243230
Species Specific ID: 1797707

Genome

Chromosome : 1

Reagents

Labome : DR_0370-cDNA