DNASU Plasmid Repository • 480.965.5697 | Email

AF1500 (Archaeoglobus fulgidus DSM 4304) in p11 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AF1500
Gene Name:  hypothetical protein
Sequence             
Original Clone ID: AF1500_1_114
Keyword: None
Species: Archaeoglobus fulgidus DSM 4304
Type: cDNA
Vector Name: p11               Format:  FUSION
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Midwest Center for Structural Genomics
University of Toronto
AfCD00370793

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 342nts         Open reading frame : 51 to 392

ATCATCATCATCACAGCAGCGGCAGAGAAAACTTGTATTTCCAGGGCCATATGTTCGAAA
ACGTGATAGCCGATATGCTCAGTGTTAATGGTGTTAAAGGTGTGTACATCGTTGATGCTG
AGGGGGCCCTGATCGAGGCCGAGTCGATTTTTTCTGACGATGATGAGGTCTATGCTGCCC
TGATTGCCGACGCTTTTAACAAAGCCTCAGAAGTTTTGAGTAAAATATCCTCCGATGAGC
CGGAGCTTTTGATGATAGACGGTAAAAAAGACCGGATTGTGGCTTCAAGGGCGGGGGACT
TAATCTTCGGCATAATTGCCGACCAGAAAACCAATTATGGATTGCTGAAAATAGAAATCA
AAAAGGCGGTTGAAAAAATAACGGCCATGGTGGGATCCTAATAACTAAGTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
TATTTCCAGGGCCAT

3' Linker Sequence:
GGATCCTAATAACTAAGT

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Tested_Not_Found
ProteinPurified: Not_Tested
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in AF1500_1_114
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: p11

p11 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  T7p
Reverse:  T7t
Description: Bacterial (E. coli) expression vector, adds His tag, TEV cleavage site; ampicillin resistance; restriction enzyme cloning.
Comments: None
Size (bp): 5704
Parent Vector: None
Empty Vector: EvNO00085126
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type bacterial origin of replication 1164 1864
promoter T7 T7 promoter 5230 5249
repressor binding site LacO LacO sequence region 5249 5271
repressor protein gene lacI lacI cds 3764 4843
selectable marker AmpR ampicillin resistance gene 407 1066
tag His 6xHis tag 5329 5349
trxn termination sequence T7 term T7 termination sequence 5446 5492

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : AF1500
GENEID : 1484727
Locus Tag : AF1500
GI : 2649062
Target GenBank: None

 

Protein

SMART domain : Robl_LC7 : Roadblock/LC7 domain
Structural Annotation Wiki : TOPSAN
UniProt : O28772

Clone

Cloning Information : 514861
HIP Master Clone ID : 426028
Original Clone ID : AF1500_1_114

Experimental

TargetTrack - Experimental data : AF1500_1_114

Organism


TAX_ID : 224325
Species Specific ID: 1484727

Reagents

Labome : AF1500-cDNA