DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Plasmid Information

TOP

Explanation of Terms


Gene: Gene Symbol:  None
Gene Name:  None
Sequence             
Original Clone ID: AF1984_1_139
Keyword: None
Species: Archaeoglobus fulgidus DSM 4304
Type: cDNA
Vector Name: p15Tv-LIC               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Midwest Center for Structural Genomics
University of Toronto
A. Savchenko
PSI
AfCD00371311

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 420nts         Open reading frame : 51 to 470

ATCATCATCATCATCACAGCAGCGGCAGAGAAAACTTGTATTTCCAGGGCATGTTCGCTG
TGCGAACGAAGTTTGTTACAAAAACAGAGGTTGTGCTCAGAACAGTTTACACCGCACTTG
AGAAAGGTCTTGCAGTAATCGGTCCCACGCAGGTTGCGGAGGAGCTTGGCGTGTCGAAAT
CAACAGCTCAGAAAATGCTGAACGAACTGTCTAAGGCAGGCTACGGCGTTTACGTCCCGA
AGAAGGGATTGGTTCTGAATGAAAGGGGAAAAATGGAAGCAAGGGCAGCGGTAAGGATGC
ACAGGCTTATAGAGTGCCTTCTCGCAGACCTCGGCGTGGAGGACTTCTGCAAGGAGGCTG
AAAAAATAGGCATGGTTGCCGGCAGCAGCCTCGTTGATGCCCTCGAAGCAAGGTACGGTG
ACAGAGAATTCTGCCCGTGTGGGAAGAGAATTCCGGAGGTGAAAAAGTGATGACGAAGCT
TGCGGCCGCACTCGAGGATCCGGCTGCTAACAAAGCCCGAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
TTGTATTTCCAGGGC

3' Linker Sequence:
TGATGACGAAGCTTG

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein _Soluble
Find experimental protocols in AF1984_1_139
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: p15Tv-LIC

p15Tv-LIC in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  T7p
Reverse:  T7t
Description: Bacterial (E. coli) expression vector, adds His tag, TEV cleavage site; ampicillin resistance; recombinational cloning (InFusion, BseRI).
Comments: None
Size (bp): 7746
Parent Vector: None
Empty Vector: EvNO00085127
Properties: acceptor (destination), bacterial expression, recombinational cloning, with tag/fusion/marker
Author Name: PSI
Midwest Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 1164 1846
negative selection marker sacB sacB cds 5901 7319
promoter T7 T7 promoter 5230 5249
recombination site LoxP LoxP sequence 5407 5440
repressor binding site LacO LacO sequence region 5249 5271
repressor protein gene lacI lacI cds 3764 4843
selectable marker AmpR ampicillin resistance gene 407 1066
trxn termination sequence T7 term T7 terminator sequence 7488 7534

 

  • Protein
  • Clone
  • Experimental

Protein

SMART domain : HTH_DTXR : Helix-turn-helix diphteria tox regulatory element
Structural Annotation Wiki : TOPSAN

Clone

Cloning Information : 561757
HIP Master Clone ID : 472075
Original Clone ID : AF1984_1_139

Experimental

TargetTrack - Experimental data : AF1984_1_139