DNASU Plasmid Repository • 480.965.5697 | Email

ACTG1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ACTBL2
Gene Name:  actin, beta-like 2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH116867.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00003792

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1128nts        
Open reading frame : 1 to 1128
Reference Sequence Alignment

ATGGAAGAAGAGATCGCCGCGCTGGTCATTGACAATGGCTCCGGCATGTGCAAAGCTGGT
TTTGCTGGGGACGACGCTCCCCGAGCCGTGTTTCCTTCCATCGTCGGGCGCCCCAGACAC
CAGGGCGTCATGGTGGGCATGGGCCAGAAGGACTCCTACGTGGGCGACGAGGCCCAGAGC
AAGCGTGGCATCCTGACCCTGAAGTACCCCATTGAGCATGGCATCGTCACCAACTGGGAC
GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGCGTGGCCCCGGAGGAG
CACCCAGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACAGAGAGAAGATGACT
CAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTG
TCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGGGTCACC
CACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTG
GCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTACAGCTTC
ACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTCGCC
CTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAGAGCTAC
GAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCGGAGGCG
CTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACCTTCAAC
TCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTGCTGTCG
GGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACCGCCCTG
GCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCGGTGTGG
ATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAG
GAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1196
Start on reference sequence 69
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 9 42
recombination site loxP site loxP recombination site 1015 1048
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ACTBL2
Symbol Nomenclature : ACTBL2
SYNONYM : ACT
Designation : actin-like protein|beta-actin-like protein 2|kappa-actin
Full Nomenclature : actin, beta-like 2
GENEID : 345651
GI : 60653036
GenBank Accession : AY892296
HGNC : 17780
MIM : 614835
Vega : OTTHUMG00000162330
Target GenBank: BC007442

 

Reference Sequence Alignment

  

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      ATGGTGGTTGAGGTTGATTCCATGCCGGCTGCCTCTTCTGTGAAGAAGCCATTTGGTCTC
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      ATGGTAGCTGAGGTTGATTCAATGCCGGCTGCCTCTTCTGTGAAGAAGCCATTTGTTCTC
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      ATGGTAGCTGAGGTTGATTCAATGCCGGCTGCCTCTTCTGTGAAGAAGCCATTTGTTCTC
NM_001083538.1      ATGGTGGTTGAGGTTGATTCCATGCCGGCTGCCTCTTCTGTGAAGAAGCCATTTGGTCTC
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      AGGAGCAAGATGGGCAAGTGGTGCTGCCGTTGCTTCCCCTGCTGCAGGGAGAGCGGCAAG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      AGGAGCAAGATGGGCAAGTGGTGCCGCCACTGCTTCCCCTGCTGCAGGGGGAGCGGCAAG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      AGGAGCAAGATGGGCAAGTGGTGCCGCCACTGCTTCCCCTGCTGCAGGGGGAGCGGCAAG
NM_001083538.1      AGGAGCAAGATGGGCAAGTGGTGCTGCCGTTGCTTCCCCTGCTACAGGGAGAGCGGCAAG
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      AGCAACGTGGGCACTTCTGGAGACCACGACGACTCTGCTATGAAGACACTCAGGAGCAAG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      AGCAACGTGGGCACTTCTGGAGACCAGGACGACTCCACTATGAAGACACTCAGGAGCAAG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      AGCAACGTGGGCACTTCTGGAGACCAGGACGACTCCACTATGAAGACACTCAGGAGCAAG
NM_001083538.1      AGCAACGTGGGCACTTCTGGAGACCACGACGACTCTGCTATGAAGACACTCAGGAGCAAG
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      ATGGGCAAGTGGTGCCGCCACTGCTTCCCCTGCTGCAGGGGGAGTGGCAAGAGCAACGTG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      ATGGGCAAGTGGTGCTGCCACTGCTTCCCCTGCTGCAGGGGGAGTGGCAAGAGCAACGTG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      ATGGGCAAGTG-------------------------------------------------
NM_001083538.1      ATGGGCAAGTGGTGCCACCACTGCTTCCCCTGCTGCAGGGGGAGTGGCAAGAGCAACGTG
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GGCGCTTCTGGAGACCACGACGACTCTGCTATGAAGACACTCAGGAACAAGATGGGCAAG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GGCACTTCTGGAGACCACGACGACTCCGCTATGAAGACGCTCAGGAGCAAGATGGGCAAG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      ------------------------------------------------------------
NM_001083538.1      GGCGCTTCTGGAGACCACGACGACTCTGCTATGAAGACACTCAGGAACAAGATGGGGAAG
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      TGGTGCTGCCACTGCTTCCCCTGCTGCAGGGGGAGCAGCAAGAGCAAGGTGGGCGCTTGG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      TGGTGCTGCCACTGCTTCCCCTGCTGCAGGGGGAGCGGCAAGAGCAACGTGGGTGCTTGG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      --GTGCTGCCACTGCTTCCCCTGCTGCAGGGGGAGCGGCAAGAGCAACGTGGGTGCTTGG
NM_001083538.1      TGGTGCTGCCACTGCTTCCCCTGCTGCAGGGGGAGCGGCAAGAGCAAGGTGGGCGCTTGG
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GGAGACTACGATGACAGTGCCTTCATGGAGCCCAGGTACCACGTCCGTGGAGAAGATCTG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GGAGACTACGACGACAGCGCCTTCGTGGAGCCGAGATACCACGTCCGTCGAGAAGATCTG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GGAGACTACGACGACAGCGCCTTCGTGGAGCCGAGATACCACGTCCGTCGAGAAGATCTG
NM_001083538.1      GGAGACTACGATGACAGCGCCTTCATGGAGCCCAGGTACCACGTCCGTGGAGAAGATCTG
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GACAAGCTCCACAGAGCTGCCTGGTGGGGTAAAGTCCCCAGAAAGGATCTCATCGTCATG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GACAAGCTCCACAGAGCTGCCTGGTGGGGTAAAGTCGCCAGAAAGGATCTGATCGTCATG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GACAAGCTCCACAGAGCTGCCTGGTGGGGTAAAGTCGCCAGAAAGGATCTGATCGTCATG
NM_001083538.1      GACAAGCTCCACAGAGCTGCCTGGTGGGGTAAAGTCCCCAGAAAGGATCTCATCGTCATG
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      CTCAGGGACACTGACGTGAACAAGCAGGACAAGCAAAAGAGGACTGCTCTACATCTGGCC
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      CTCAGGGACACTGACGTGAACAAGCAGGACAAGCAAAAGAGGACTGCTCTACATCTGGCC
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      CTCAGGGACACTGACGTGAACAAGCAGGACAAGCAAAAGAGGACTGCTCTACATCTGGCC
NM_001083538.1      CTCAGGGACACTGACGTGAACAAGAAGGACAAGCAAAAGAGGACTGCTCTACATCTGGCC
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      TCTGCCAATGGGAATTCAGAAGTAGTAAAACTCCTGCTGGACAGACGATGTCAACTTAAT
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      TCTGCCAATGGGAATTCAGGAGTAGTAAAACTCCTGCTGGACAGACGATGTCAACTTAAT
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      TCTGCCAATGGGAATTCAGGAGTAGTAAAACTCCTGCTGGACAGACGATGTCAACTTAAT
NM_001083538.1      TCTGCCAATGGGAATTCAGAAGTAGTAAAACTCCTGCTGGACAGACGATGTCAACTTAAT
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GTCCTTGACAACAAAAAGAGGACAGCTCTGATAAAGGCCGTACAATGCCAGGAAGATGAA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GTCCTTGACAACAAAAAGAGGACAGCTCTGACAAAGGCCGTACAATGCCAGGAAGATGAA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GTCCTTGACAACAAAAAGAGGACAGCTCTGACAAAGGCCGTACAATGCCAGGAAGATGAA
NM_001083538.1      GTCCTTGACAACAAAAAGAGGACAGCTCTGATAAAGGCCGTACAATGCCAGGAAGATGAA
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      TGTGCGTTAATGTTGCTGGAACATGGCACTGATCCAAATATTCCAGATGAGTATGGAAAT
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      TGTGCGTTAATGTTGCTGGAACATGGCACTGATCCAAACATTCCAGATGAGTATGGAAAT
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      TGTGCGTTAATGTTGCTGGAACATGGCACTGATCCAAACATTCCAGATGAGTATGGAAAT
NM_001083538.1      TGTGCGTTAATGTTGCTGGAACATGGCACTGATCCAAATATTCCAGATGAGTATGGAAAT
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      ACCACTCTGCACTACGCTATCTATAATGAAGATAAATTAATGGCCAAAGCACTGCTCTTA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      ACCACTCTACACTACGCTATCTACAATGAAGATAAATTAATGGCCAAAGCACTGCTCTTA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      ACCACTCTACACTACGCTATCTACAATGAAGATAAATTAATGGCCAAAGCACTGCTCTTA
NM_001083538.1      ACCACTCTGCACTACGCTATCTATAATGAAGATAAATTAATGGCCAAAGCACTGCTCTTA
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      TATGGTGCTGATATCGAATCAAAAAACAAGCATGGCCTCACACCACTGTTACTTGGTGTA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      TACGGTGCTGATATCGAATCAAAAAACAAGCATGGCCTCACACCACTGCTACTTGGTGTA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      TACGGTGCTGATATCGAATCAAAAAACAAGCATGGCCTCACACCACTGCTACTTGGTGTA
NM_001083538.1      TATGGTGCTGATATCGAATCAAAAAACAAGCATGGCCTCACACCACTGTTACTTGGTGTA
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      CATGAGCAAAAACAGCAAGTCGTGAAATTTTTAATTAAGAAAAAAGCGAATTTAAATGCA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      CATGAGCAAAAACAGCAAGTGGTGAAATTTTTAATCAAGAAAAAAGCGAATTTAAATGCG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      CATGAGCAAAAACAGCAAGTGGTGAAATTTTTAATCAAGAAAAAAGCGAATTTAAATGCA
NM_001083538.1      CATGAGCAAAAACAGCAAGTCGTGAAATTTTTAATCAAGAAAAAAGCGAATTTAAATGCA
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      CTGGATAGATATGGAAGAACTGCTCTCATACTTGCTGTATGTTGTGGATCAGCAAGTATA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      CTGGATAGATATGGAAGAACTGCTCTCATACTTGCTGTATGTTGTGGATCAGCAAGTATA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      CTGGATAGATATGGAAGAACTGCTCTCATACTTGCTGTATGTTGTGGATCAGCAAGTATA
NM_001083538.1      CTGGATAGATATGGAAGGACTGCTCTCATACTTGCTGTATGTTGTGGATCAGCAAGTATA
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GTCAGCCTTCTACTTGAGCAAAATATTGATGTATCTTCTCAAGATCTATCTGGACAGACG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GTCAGCCTTCTACTTGAGCAAAATATTGATGTATCTTCTCAAGATCTATCTGGACAGACG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GTCAGCCTTCTACTTGAGCAAAATATTGATGTATCTTCTCAAGATCTATCTGGACAGACG
NM_001083538.1      GTCAGCCTTCTACTTGAGCAAAATATTGATGTATCTTCTCAAGATCTATCTGGACAGACG
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GCCAGAGAGTATGCTGTTTCTAGTCATCATCATGTAATTTGCCAGTTACTTTCTGACTAC
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GCCAGAGAGTATGCTGTTTCTAGTCATCATCATGTAATTTGCCAGTTACTTTCTGACTAC
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GCCAGAGAGTATGCTGTTTCTAGTCATCATCATGTAATTTGCCAGTTACTTTCTGACTAC
NM_001083538.1      GCCAGAGAGTATGCTGTTTCTAGTCATCATCATGTAATTTGCCAGTTACTTTCTGACTAC
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      AAAGAAAAACAGATGCTAAAAATCTCTTCTGAAAACAGCAATCCAGAACAAGACTTAAAG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      AAAGAAAAACAGATGCTAAAAATCTCTTCTGAAAACAGCAATCCAGAACAAGACTTAAAG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      AAAGAAAAACAGATGCTAAAAATCTCTTCTGAAAACAGCAATCCAGAACAAGACTTAAAG
NM_001083538.1      AAAGAAAAACAGATGCTAAAAATCTCTTCTGAAAACAGCAATCCAGAACAAGAGTTAAAG
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      CTGACATCAGAGGAAGAGTCACAAAGGTTCAAAGGCAGTGAAAATAGCCAGCCAGAGAAA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      CTGACATCAGAGGAAGAGTCACAAAGGTTCAAAGGCAGTGAAAATAGCCAGCCAGAGAAA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      CTGACATCAGAGGAAGAGTCACAAAGGTTCAAAGGCAGTGAAAATAGCCAGCCAGAGAAA
NM_001083538.1      CTGACATCAGAGGAAGAGTCACAAAGGTTCAAAGGCAGTGAAAATAGCCAGCCAGAGAAA
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      ATGTCTCAAGAACCAGAAATAAATAAGGATGGTGATAGAGAGGTTGAAGAAGAAATGAAG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      ATGTCTCAAGAACCAGAAATAAATAAGGATGGTGATAGAGAGGTTGAAGAAGAAATGAAG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      ATGTCTCAAGAACCAGAAATAAATAAGGATGGTGATAGAGAGGTTGAAGAAGAAATGAAG
NM_001083538.1      ATGTCTCAAGAACTAGAAATAAATAAGGATGGTGATAGAGAGGTTGAAGAAGAAATGAAG
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      AAGCATGAAAGTAATAATGTGGGATTACTAGAAAACCTGACTAATGGTGTCACTGCTGGC
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      AAGCATGAAAGTAATAATGTGGGATTACTAGAAAACCTGAGTAATGGTGTCACTGCTGGC
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      AAGCATGAAAGTAATAATGTGGGATTACTAGAAAACCTGAGTAATGGTGTCACTGCTGGC
NM_001083538.1      AAGCATGAAAGTAATAATGTGGGATTACTAGAAAACCTGACTAATGGTGTCACTGCTGGC
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      AATGGTGATAATGGATTAATTCCTCAAAGGAAGAGCAGAACACCTGAAAATCAGCAATTT
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      AATGGTGATGATGGATTAATTCCTCAAAGGAAGAGCAGAACACCTGAAAATCAGCAATTT
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      AATGGTGATGATGGATTAATTCCTCAAAGGAAGAGCAGAACACCTGAAAATCAGCAATTT
NM_001083538.1      AATGGTGATAATGGATTAATTCCTCAAAGGAAGAGCAGAACACCTGAAAATCAGCAATTT
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      CCTGACAACGAAAGTGAAGAGTATCACAGAATTTGTGAATTACTTTCTGACTACAAAGAA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      CCTGACAACGAAAGTGAAGAGTATCACAGAATTTGCGAATTAGTTTCTGACTACAAAGAA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      CCTGACAACGAAAGTGAAGAGTATCACAGAATTTGCGAATTAGTTTCTGACTACAAAGAA
NM_001083538.1      CCTGACAACGAAAGTGAAGAGTATCACAGAATTTGTGAATTACTTTCTGACTACAAAGAA
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      AAGCAGATGCCAAAATACTCTTCTGAAAACAGCAACCCAGAACAAGACTTAAAGCTGACA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      AAACAGATGCCAAAATACTCTTCTGAAAACAGCAACCCAGAACAAGACTTAAAGCTGACA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      AAACAGATGCCAAAATACTCTTCTGAAAACAGCAACCCAGAACAAGACTTAAAGCTGACA
NM_001083538.1      AAGCAGATGCCAAAATACTCTTCTGAAAACAGCAACCCAGAACAAGACTTAAAGCTGACA
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      TCAGAGGAAGAGTCACAAAGGCTTAAAGGCAGTGAAAATGGCCAGCCAGAGAAAAGATCT
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      TCAGAGGAAGAGTCACAAAGGCTTAAAGGCAGTGAAAATGGCCAGCCAGAGAAAAGATCT
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      TCAGAGGAAGAGTCACAAAGGCTTAAAGGCAGTGAAAATGGCCAGCCAGAGAAAAGATCT
NM_001083538.1      TCAGAGGAAGAGTCACAAAGGCTTAAAGGCAGTGAAAATGGCCAGCCAGAGAAAAGATCT
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      CAAGAACCAGAAATAAATAAGGATGGTGATAGAGAGCTAGAAAATTTTATGGCTATCGAA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      CAAGAACCAGAAATAAATAAGGATGGTGATAGAGAGCTAGAAAATTTTATGGCTATCGAA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      CAAGAACCAGAAATAAATAAGGATGGTGATAGAGAGCTAGAAAATTTTATGGCTATCGAA
NM_001083538.1      CAAGAACCAGAAATAAATAAGGATGGTGATAGAGAGCTAGAAAATTTTATGGCTATCGAA
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GAAATGAAGAAGCACAGAAGTACTCATGTCGGATTCCCAGAAAACCTGACTAATGGTGCC
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GAAATGAAGAAGCACGGAAGTACTCACGTCGGATTCCCAGAAAACCTGACTAATGGTGCC
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GAAATGAAGAAGCACGGAAGTACTCACGTCGGATTCCCAGAAAACCTGACTAATGGTGCC
NM_001083538.1      GAAATGAAGAAGCACGGAAGTACTCATGTCGGATTCCCAGAAAACCTGACTAATGGTGCC
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      ACTGCTGGCAATGGTGATGATGGATTAATTCCTCCAAGGAAGAGCAGAACACCTGAAAGC
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      ACTGCTGGCAATGGTGATGATGGATTAATTCCTCCAAGGAAGAGCAGAACACCTGAAAGC
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      ACTGCTGGCAATGGTGATGATGGATTAATTCCTCCAAGGAAGAGCAGAACACCTGAAAGC
NM_001083538.1      ACTGCTGGCAATGGTGATGATGGATTAATTCCTCCAAGGAAGAGCAGAACACCTGAAAGC
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      CAGCAATTTCCTGACACTGAGAATGAAGAGTATCACAGTGACGAACAAAATGATACTCAG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      CAGCAATTTCCTGACACTGAGAATGAAGAGTATCACAGTGACGAACAAAATGATACTCAG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      CAGCAATTTCCTGACACTGAGAATGAAGAGTATCACAGTGACGAACAAAATGATACTCAG
NM_001083538.1      CAGCAATTTCCTGACACTGAGAATGAAGAGTATCACAGTGACGAACAAAATGATACTCAG
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      AAGCAATTTTGTGAAGAACAGAACACTGGAATATTACACGATGAGATTCTGATTCATGAA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      AAGCAATTTTGTGAAGAACAGAACACTGGAATATTACACGATGAGATTCTGATTCATGAA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      AAGCAATTTTGTGAAGAACAGAACACTGGAATATTACACGATGAGATTCTGATTCATGAA
NM_001083538.1      AAGCAATTTTGTGAAGAACAGAACACTGGAATATTACACGATGAGATTCTGATTCATGAA
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GAAAAGCAGATAGAAGTGGTTGAAAAAATGAATTCTGAGCTTTCTCTTAGTTGTAAGAAA
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GAAAAGCAGATAGAAGTGGTTGAAAAAATGAATTCTGAGCTTTCTCTTAGTTGTAAGAAA
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GAAAAGCAGATAGAAGTGGTTGAAAAAATGAATTCTGAGCTTTCTCTTAGTTGTAAGAAA
NM_001083538.1      GAAAAGCAGATAGAAGTGGTTGAAAAAATGAATTCTGAGCTTTCTCTTAGTTGTAAGAAA
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GAAAAAGACATCTTGCATGAAAATAGTACGTTGCGGGAAGAAATTGCCATGCTAAGACTG
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GAAAAAGACTTCTTGCATGAAAATAGTACGTTGCGGGAAGAAATTGCCATGCTAAGACTG
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GAAAGAGACTTCTTGCATGAAAATAGTATGTTGCGGGAAGAAATTGCCATGCTAAGACTG
NM_001083538.1      GAAAAAGACGTCTTGCATGAAAATAGTACGTTGCGGGAAGAAATTGCCATGCTAAGACTG
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------------
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GAGCTAGACACAATGAAACATCAGAGCCAGCTAAGAGAAAAGAAATATTTGGAGGATATT
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GAGCTAGACACAATGAAACATCAGAGCCAGCTAAGAAAAAAGAAATATTTGGAGGATATT
NM_001615.3         ------------------------------------------------------------
NM_001141945.1      ------------------------------------------------------------
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ------------------------------------------------------------
NM_001100.3         ------------------------------------------------------------
NM_001613.2         ------------------------------------------------------------
NM_001277083.1      GAGCTAGACACAATGAAACATCAGAGCCAGCTAAGAAAAAAGAAATATTTGGAGGATATT
NM_001083538.1      GAGCTAGACACAATGAAACATCAGAGCCAGCTAAGAGAAAAGAAATATTTGGAGGATATT
                                                                                

HsCD00003792        ------------------------------------------------------------
NM_005159.4         ------------------------------------------------------ATGTGT
NM_001199954.1      ------------------------------------------------------------
NM_001099771.2      GAAAGTGTGAAAAAAAGGAATGATAATCTTTTAAAGGCTCTACAATTGAATGAGCTCACC
NM_001101.3         ------------------------------------------------------------
NM_001277406.1      GAAAGTGTGAAAAAAAAGAATGATAATCTTTTAAAGGCTCTACAATTGAATGAGCTCACC
NM_001615.3         ---------------------------------------------------------ATG
NM_001141945.1      ------------------------------------------------------ATGTGT
NM_001614.3         ------------------------------------------------------------
NM_001017992.3      ---------------------------------------------------------ATG
NM_001100.3         ------------------------------------------------------ATGTGC
NM_001613.2         ------------------------------------------------------ATGTGT
NM_001277083.1      GAAAGTGTGAAAAAAAAGAATGATAATCTTTTAAAGGCTCTACAATTGAATGAGCTCACC
NM_001083538.1      GAAAGTGTGAAAAAAAAGAATGATAATCTTTTAAAGGCTCTACAATTGAATGAGCTCACC
                                                                                

HsCD00003792        ATGGAAGAAGAGATCGCCGCGCTGGTCATTGACAATGGCTCCGGCATGTGCAAAGCTGGT
NM_005159.4         GACGACGAGGAGACCACCGCCCTGGTGTGCGACAACGGCTCTGGGCTGGTGAAGGCCGGC
NM_001199954.1      ATGGAAGAAGAGATCGCCGCGCTGGTCATTGACAATGGCTCCGGCATGTGCAAAGCTGGT
NM_001099771.2      ATGGATGATGATACCGCTGTGCTCGTCATTGACAACGGCTCTGGCATGTGCAAGGCCGGC
NM_001101.3         ATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGC
NM_001277406.1      ATGGATGATGATACCGCCGTGCTCGTCATTGACAACGGCTCTGGCATGTGCAAGGCCGGC
NM_001615.3         TGTGAAGAGGAGACCACCGCGCTCGTGTGTGACAATGGCTCTGGCCTGTGCAAGGCAGGC
NM_001141945.1      GAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAGGCCGGC
NM_001614.3         ATGGAAGAAGAGATCGCCGCGCTGGTCATTGACAATGGCTCCGGCATGTGCAAAGCTGGT
NM_001017992.3      ACTGACAATGAGCTGTCTGCCTTGGTAGTGGATAATGGGTCAGGGATGTGCAAGGCAGGC
NM_001100.3         GACGAAGACGAGACCACCGCCCTCGTGTGCGACAATGGCTCCGGCCTGGTGAAAGCCGGC
NM_001613.2         GAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAGGCCGGC
NM_001277083.1      ATGGATGATGATACCGCTGTGCTCGTCATTGACAACGGCTCTGGCATGTGCAAGGCCGGC
NM_001083538.1      ATGGATGATGATACCGCCGTGCTCGTCATTGACAACGGCTCTGGCATGTGCAAGGCCGGC
                       ** .* ** .   * *   * **    ** ** ** ** ** .*    **.** ** 

HsCD00003792        TTTGCTGGGGACGACGCTCCCCGAGCCGTGTTTCCTTCCATCGTCGGGCGCCCCAGACAC
NM_005159.4         TTTGCGGGCGATGACGCGCCCCGCGCTGTCTTCCCGTCCATCGTGGGCCGCCCGCGGCAC
NM_001199954.1      TTTGCTGGGGACGACGCTCCCCGAGCCGTGTTTCCTTCCATCGTCGGGCGCCCCAGACAC
NM_001099771.2      TTTGCGGGCGACGATGCCCCCCGGGCTGTCTTCCCTTCCATCGTGGGGCGCCCCAGGCAG
NM_001101.3         TTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCCAGGCAC
NM_001277406.1      TTTGCGGGCGACGATGCCCCCCGGGCTGTCTTCCCTTCCATCGTGGGGCGCCCCAGGCAG
NM_001615.3         TTCGCAGGAGATGATGCCCCCCGGGCTGTCTTCCCCTCCATTGTGGGCCGCCCTCGCCAC
NM_001141945.1      TTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCCAGACAT
NM_001614.3         TTTGCTGGGGACGACGCTCCCCGAGCCGTGTTTCCTTCCATCGTCGGGCGCCCCAGACAC
NM_001017992.3      TTTGGTGGTGACGATGCCCCCCGGGCTGTGTTCCCCTCCATGATAGGGCGTCCTCGACAC
NM_001100.3         TTCGCCGGGGATGACGCCCCTAGGGCCGTGTTCCCGTCCATCGTGGGCCGCCCCCGACAC
NM_001613.2         TTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCCAGACAT
NM_001277083.1      TTTGCGGGCGACGATGCCCCCCGGGCTGTCTTCCCTTCCATCGTGGGGTGCCCCAGGCAG
NM_001083538.1      TTTGCGGGCGACGATGCCCCCCGGGCTGTCTTCCCTTCCATCGTGGGGCGCCCCAGGCAG
                    ** *  ** ** ** ** ** .* ** ** ** ** ***** .* **  * ** .* ** 

HsCD00003792        CAGGGCGTCATGGTGGGCATGGGCCAGAAGGACTCCTACGTGGGCGACGAGGCCCAGAGC
NM_005159.4         CAGGGAGTTATGGTGGGTATGGGTCAGAAGGACTCCTACGTAGGTGATGAAGCCCAGAGC
NM_001199954.1      CAGGGCGTCATGGTGGGCATGGGCCAGAAGGACTCCTACGTGGGCGACGAGGCCCAGAGC
NM_001099771.2      CAGGGCATGATGGGGGGCATGCATCAGAAAGAGTCCTATGTGGGCAAGGAGGCCCAGAGC
NM_001101.3         CAGGGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGCGACGAGGCCCAGAGC
NM_001277406.1      CAGGGCATGATGGGGGGCATGCATCAGAAAGAGTCCTATGTGGGCAAGGAGGCCCAGAGC
NM_001615.3         CAGGGTGTGATGGTGGGAATGGGCCAGAAAGACAGCTATGTGGGGGATGAGGCTCAGAGC
NM_001141945.1      CAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGC
NM_001614.3         CAGGGCGTCATGGTGGGCATGGGCCAGAAGGACTCCTACGTGGGCGACGAGGCCCAGAGC
NM_001017992.3      CAGGGCGTTATGGTAGGCATGGGCCAGAAGGACTGCTACGTGGGAGATGAGGCTCAGAGC
NM_001100.3         CAGGGCGTCATGGTCGGTATGGGTCAGAAAGATTCCTACGTGGGCGACGAGGCTCAGAGC
NM_001613.2         CAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGC
NM_001277083.1      CAGGGCATGATGGGGGGCATGCATCAGAAAGAGTCCTATGTGGGCAAGGAGGCCCAGAGC
NM_001083538.1      CAGGGCATGATGGGGGGCATGCATCAGAAAGAGTCCTATGTGGGCAAGGAGGCCCAGAGC
                    ***** .* ****  ** *** . **.**.** : *** **.** .* **.** ******

HsCD00003792        AAGCGTGGCATCCTGACCCTGAAGTACCCCATTGAGCATGGCATCGTCACCAACTGGGAC
NM_005159.4         AAGAGAGGCATCCTGACCCTGAAGTATCCCATCGAGCATGGTATCATCACCAACTGGGAC
NM_001199954.1      AAGCGTGGCATCCTGACCCTGAAGTACCCCATTGAGCATGGCATCGTCACCAACTGGGAC
NM_001099771.2      AAAAGAGGCATCCTGACCCTGAAGTACCCCATGGAACACGGCATCATCACCAACTGGGAT
NM_001101.3         AAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGAC
NM_001277406.1      AAGAGAGGCATCCTGACCCTGAAGTACCCCATGGAACACGGCATCATCACCAACTGGGAT
NM_001615.3         AAGCGAGGGATCCTAACTCTCAAATACCCCATTGAACACGGCATCATCACCAACTGGGAT
NM_001141945.1      AAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGAC
NM_001614.3         AAGCGTGGCATCCTGACCCTGAAGTACCCCATTGAGCATGGCATCGTCACCAACTGGGAC
NM_001017992.3      AAGAGAGGCGTCCTGACCCTGAAGTATCCTATCGAGCATGGAGTGGTCACCAACTGGGAC
NM_001100.3         AAGAGAGGTATCCTGACCCTGAAGTACCCTATCGAGCACGGCATCATCACCAACTGGGAT
NM_001613.2         AAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGAC
NM_001277083.1      AAGAGAGGCATCCTGACCCTGAAGTACCCCATGGAACACGGCATCATCACCAACTGGGAT
NM_001083538.1      AAGAGAGGCATCCTGACCCTGAAGTACCCCATGGAACACGGCATCATCACCAACTGGGAT
                    **..*:** .**** ** ** **.** ** ** **.** ** .* .************* 

HsCD00003792        GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGCGTGGCCCCGGAGGAG
NM_005159.4         GACATGGAGAAGATCTGGCACCACACCTTCTACAATGAGCTCCGTGTGGCTCCCGAGGAG
NM_001199954.1      GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGCGTGGCCCCGGAGGAG
NM_001099771.2      GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGTGGCTCCCGAGGAG
NM_001101.3         GACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAG
NM_001277406.1      GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGTGGCCCCTGAGGAG
NM_001615.3         GACATGGAGAAGATCTGGCACCACTCCTTCTACAATGAGCTGCGTGTAGCACCTGAAGAG
NM_001141945.1      GACATGGAAAAGATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCTGAAGAG
NM_001614.3         GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGCGTGGCCCCGGAGGAG
NM_001017992.3      GATATGGAAAAGATCTGGTACCACACATTCTACAATGAGCTCCGTGTGGCACCAGATGAG
NM_001100.3         GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTTCGCGTGGCTCCCGAGGAG
NM_001613.2         GACATGGAAAAGATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCTGAAGAG
NM_001277083.1      GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGTGGCCCCCGAGGAG
NM_001083538.1      GACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGTGGCTCCCGAGGAG
                    ** *****.**.****** *****:* ******** ***** ** ** ** ** ** ***

HsCD00003792        CACCCAGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACAGAGAGAAGATGACT
NM_005159.4         CACCCCACCCTGCTCACAGAGGCCCCGCTGAACCCCAAGGCCAACCGGGAGAAGATGACT
NM_001199954.1      CACCCAGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACAGAGAGAAGATGACT
NM_001099771.2      CACCCCGTCCTGCTGACCGAGGCCACCCTGAACCCTAAGGCCAACCGCGAGAAGATGACC
NM_001101.3         CACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACC
NM_001277406.1      CACCCCATCCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACC
NM_001615.3         CACCCCACCCTGCTCACAGAGGCTCCCCTAAATCCCAAGGCCAACAGGGAAAAGATGACC
NM_001141945.1      CATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAAATGACT
NM_001614.3         CACCCAGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACAGAGAGAAGATGACT
NM_001017992.3      CATCCCATCCTCCTCACCGAGGCACCCCTGAACCCCAAGATCAACCGGGAAAAGATGACT
NM_001100.3         CACCCCACCCTGCTCACCGAGGCCCCCCTCAATCCCAAGGCCAACCGCGAGAAGATGACC
NM_001613.2         CATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAAATGACT
NM_001277083.1      CACCCCATCCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACC
NM_001083538.1      CACCCCATCCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACC
                    ** **..  ** ** ** ***** .* ** ** ** ***. ****.* **.**.***** 

HsCD00003792        CAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTG
NM_005159.4         CAGATCATGTTTGAGACCTTCAATGTCCCTGCCATGTACGTGGCCATCCAGGCAGTGCTA
NM_001199954.1      CAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTG
NM_001099771.2      CAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTGGCCATCCAGGCTGTGCTG
NM_001101.3         CAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCTGTGCTA
NM_001277406.1      CAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTGGCCATCCAGGCCATGCTG
NM_001615.3         CAGATCATGTTTGAAACCTTCAATGTCCCTGCCATGTACGTCGCCATTCAAGCTGTGCTC
NM_001141945.1      CAAATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCGGTGCTG
NM_001614.3         CAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTG
NM_001017992.3      CAGATCATGTTCGAGGCTTTCAACACACCAGCCATGTATGTCGCCATCCAGGCTGTGCTG
NM_001100.3         CAGATCATGTTTGAGACCTTCAACGTGCCCGCCATGTACGTGGCCATCCAGGCCGTGCTG
NM_001613.2         CAAATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCGGTGCTG
NM_001277083.1      CAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTGGCCATCCAGGCCATGCTG
NM_001083538.1      CAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTGGCCATCCAGGCCGTGCCG
                    **.** ***** **..* ***** .  ** ******** ** ** ** **.** .***  

HsCD00003792        TCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGGGTCACC
NM_005159.4         TCCCTGTATGCTTCTGGCCGTACCACAGGCATTGTTCTGGACTCTGGGGATGGTGTAACT
NM_001199954.1      TCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGGGTCACC
NM_001099771.2      TCCCTGTACACCTCTGGCCGTACTACTGGCATCGTGATGGACTCTGGTGACGGGGTCACC
NM_001101.3         TCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACC
NM_001277406.1      TCCCTGTACACCTCTGGCCGTACTACTGGCATCGTGATGGACTCTGGTGACGGGGTCACC
NM_001615.3         TCCCTCTATGCCTCTGGCCGCACGACAGGCATCGTCCTGGATTCAGGTGATGGCGTCACC
NM_001141945.1      TCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGCTGGACTCTGGAGATGGTGTCACC
NM_001614.3         TCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGGGTCACC
NM_001017992.3      TCCCTCTATGCCTCAGGACGGACCACAGGCATCGTGATGGATTCTGGGGATGGGGTCACT
NM_001100.3         TCCCTCTACGCCTCCGGCAGGACCACCGGCATCGTGCTGGACTCCGGCGACGGCGTCACC
NM_001613.2         TCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGCTGGACTCTGGAGATGGTGTCACC
NM_001277083.1      TCCCTGTACACCTCTGGCCGTACTACTGGCATCGTGATGGACTCTGGTGACGGGGTCACC
NM_001083538.1      TCCCTGTACACCTCTGGCCGTACTACTGGCATCGTGATGGACTCTGGTGACGGGGTCACC
                    ** ** ** .* ** ** .* ** ** ***** ** .**** ** ** ** ** **.** 

HsCD00003792        CACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTG
NM_005159.4         CACAATGTCCCCATCTATGAGGGCTACGCTTTGCCCCATGCCATCATGCGTCTGGATCTG
NM_001199954.1      CACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTG
NM_001099771.2      CACACTGTGCCCATCTATGAGGGGAATGCCCTCCCCCATGCCACCCTGCGCCTAGACCTG
NM_001101.3         CACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTG
NM_001277406.1      CACACTGTGCCCATCTATGATGGGAATGCCCTCCCCCATGCCACCCTGCGCCTAGACCTG
NM_001615.3         CACAATGTCCCCATCTATGAAGGCTATGCCCTGCCCCATGCCATCATGCGCCTGGACTTG
NM_001141945.1      CACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTG
NM_001614.3         CACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTG
NM_001017992.3      CACATCGTGCCCATCTATGAAGGTTATGCCCTGCCTCATGCCATTCTACGCCTGGATCTG
NM_001100.3         CACAACGTGCCCATTTATGAGGGCTACGCGCTGCCGCACGCCATCATGCGCCTGGACCTG
NM_001613.2         CACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTG
NM_001277083.1      CACACTGTGCCCATCTATGATGGGAATGCCCTCCCCCATGCCACCCTGCGCCTAGACCTG
NM_001083538.1      CACACTGTGCCCATCTATGAGGGGAATGCCCTCCCCCATGCCACCCTGCGCCTAGACCTG
                    ****  ** ***** ** ** ** :* **  * ** ** ****  .*.** **.**  **

HsCD00003792        GCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTACAGCTTC
NM_005159.4         GCTGGTCGGGACCTCACTGACTACCTCATGAAGATCCTCACTGAGCGTGGCTACTCCTTT
NM_001199954.1      GCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTACAGCTTC
NM_001099771.2      GCTGGGCGGGAACTGCCTGACTACCTCATGAAGATCCTCACCGAGCATGGCTATAGGTTC
NM_001101.3         GCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTC
NM_001277406.1      GCTGGGCGGGAACTGACTGACTACCTCATGAAGATCCTCACCGAGCGTGGCTATAGGTTC
NM_001615.3         GCTGGCCGTGACCTCACGGACTACCTCATGAAGATCCTCACAGAGAGAGGCTATTCCTTT
NM_001141945.1      GCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTC
NM_001614.3         GCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTACAGCTTC
NM_001017992.3      GCAGGGAGAGACCTGACTGATTACCTCATGAAGATCCTGACAGAGCGAGGCTATAACTTC
NM_001100.3         GCGGGCCGCGATCTCACCGACTACCTGATGAAGATCCTCACTGAGCGTGGCTACTCCTTC
NM_001613.2         GCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTC
NM_001277083.1      GCTGGGCGGGAACTGACTGACTACCTCATGAAGATCCTCACCGAGCGTGGCTATAGGTTC
NM_001083538.1      GCTGGGCGGGAACTGCCTGACTACCTCATGAAGATCCTCACCGAGCGTGGCTATAGGTTC
                    ** ** .* ** ** .* ** ***** *********** ** ***.. ***** :  ** 

HsCD00003792        ACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTCGCC
NM_005159.4         GTCACCACTGCTGAACGTGAAATTGTCCGTGACATTAAAGAGAAGCTGTGCTATGTCGCC
NM_001199954.1      ACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTCGCC
NM_001099771.2      ACCACCATGGCCGAGCGGGAAATCGTGCGTGACATCAAAGAGAAGCTGTGCTATGTTGCC
NM_001101.3         ACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTGTGCTACGTCGCC
NM_001277406.1      ACCACCATGGCCGAGCGGGAAATCGTGCGTGACATCAAAGAGAAGCTGTGCTATGTTGCC
NM_001615.3         GTGACCACAGCTGAGAGAGAAATTGTGCGAGACATCAAGGAGAAGCTGTGCTATGTGGCC
NM_001141945.1      GTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCT
NM_001614.3         ACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTCGCC
NM_001017992.3      ACCACCACTGCTGAGCGGGAGATTGTGCGAGATGTCAAAGAGAAGCTGTGCTACGTAGCC
NM_001100.3         GTGACCACAGCTGAGCGCGAGATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTGGCC
NM_001613.2         GTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCT
NM_001277083.1      ACCACCATGGCCGAGCGGGAAATCGTGCGTGACATCAAAGAGAAGCTGTGCTATGTTGCC
NM_001083538.1      ACCACCATGGCCGAGCGGGAAATCGTGCGTGACATCAAAGAGAAGCTGTGCTATGTTGCC
                    .  ** *  ** **..* **.** ** ** ** .* **.*****.***** ** ** ** 

HsCD00003792        CTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAGAGCTAC
NM_005159.4         CTGGATTTTGAGAATGAGATGGCCACAGCTGCCTCTTCCTCCTCCCTGGAGAAGAGCTAT
NM_001199954.1      CTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAGAGCTAC
NM_001099771.2      CTGGACTTCGAGCAGGAGATGGCCACGGTGGCCTCCAGCTCCTCCCTAGAGAAGAGCTAC
NM_001101.3         CTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGCTCCTCCCTGGAGAAGAGCTAC
NM_001277406.1      CTGGACTTCGAGCAGGAGATGGCCATGGCGGCCTCCAGCTCCTCCCTAGAGAAGAGCTAC
NM_001615.3         CTGGATTTTGAGAATGAGATGGCCACAGCAGCTTCCTCTTCCTCCCTGGAGAAGAGCTAT
NM_001141945.1      CTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTAC
NM_001614.3         CTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAGAGCTAC
NM_001017992.3      CTGGACTTTGAGCAGGAGATGGTCAGGGCAGCCGCATCCTCCTCACCGGAACGGAGCTAT
NM_001100.3         CTGGACTTCGAGAACGAGATGGCGACGGCCGCCTCCTCCTCCTCCCTGGAAAAGAGCTAC
NM_001613.2         CTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTAC
NM_001277083.1      CTGGACTTCGAGCAGGAGATGGCCATGGTGGCCTCCAGCTCCTCCCTAGAGAAGAGCTAC
NM_001083538.1      CTGGACTTCGAGCAGGAGATGGCCACGGCGGCCTCCAGCTCCTCCCTAGAGAAGAGCTAC
                    ***** ** **..* *******  *  *  **  * :  ** ** *  **...*** ** 

HsCD00003792        GAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCGGAGGCG
NM_005159.4         GAACTGCCTGATGGCCAAGTCATCACTATTGGCAATGAGCGCTTCCGCTGTCCTGAGACA
NM_001199954.1      GAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCGGAGGCG
NM_001099771.2      GAGCTGCCCGATGGCCAGGTCATCACCATCGGCAACGAGCGGTTCCGCTGCCCCGAGGCG
NM_001101.3         GAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGCTGCCCTGAGGCA
NM_001277406.1      GAGCTGCCCGATGGCCAGGTCATCACCATCGGCAACGAGTGGTTCCGCTGCCCCGAGGCG
NM_001615.3         GAGCTGCCAGATGGGCAGGTTATCACCATTGGCAATGAGCGCTTCCGCTGCCCTGAGACC
NM_001141945.1      GAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACC
NM_001614.3         GAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCGGAGGCG
NM_001017992.3      GAACTTCCTGATGGGCAGGTGATCACCATTGGGAATGAACGCTTCCGATGCCCTGAAGCC
NM_001100.3         GAGCTGCCAGACGGGCAGGTCATCACCATCGGCAACGAGCGCTTCCGCTGCCCGGAGACG
NM_001613.2         GAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACC
NM_001277083.1      GAGCTGCCCGATGGCCAGGTCATCACCATCAGCAACGAGTGGTTCCGCTGCCCCGAGGCG
NM_001083538.1      GAGCTGCCCGATGGCCAGGTCATCACCATCGGCAACGAGCGGTTCCGCTGCCCCGAGGCG
                    **. * ** ** ** **.** ***** ** .* ** **. * ***** ** ** **..* 

HsCD00003792        CTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACCTTCAAC
NM_005159.4         CTCTTCCAGCCCTCCTTCATTGGTATGGAATCTGCTGGCATCCATGAAACAACTTACAAT
NM_001199954.1      CTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACCTTCAAC
NM_001099771.2      CTCTTCCAGCCTTGCTTCCTGGGCATGGAATCCTGTGGCATCCATGAAACTACCTTCAAC
NM_001101.3         CTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAAC
NM_001277406.1      CTCTTCCAGCCTTGCTTCCTGGGCATGGAATCCTGTGGCATCCATGAAACTACCTTCAAC
NM_001615.3         CTCTTCCAGCCTTCCTTTATTGGCATGGAGTCCGCTGGAATTCATGAGACAACCTACAAT
NM_001141945.1      CTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAAC
NM_001614.3         CTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACCTTCAAC
NM_001017992.3      ATTTTCCAGCCTTCCTTTCTGGGCATTGAGTCCAGTGGGATCCATGAGACAACCTTCAAC
NM_001100.3         CTCTTCCAGCCCTCCTTCATCGGTATGGAGTCGGCGGGCATTCACGAGACCACCTACAAC
NM_001613.2         CTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAAC
NM_001277083.1      CTCTTCCAGCCTTGCTTCCTGGGCATGGAATCCTGTGGCATCCATGAAACTACCTTCAAC
NM_001083538.1      CTCTTCCAGCCTTGCTTCCTGGGCATGGAATCCTGTGGCATCCATGAAACTACCTTCAAC
                    .* ******** * *** .* ** ** **.**    ** ** ** **.** ** *:*** 

HsCD00003792        TCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTGCTGTCG
NM_005159.4         AGCATCATGAAGTGTGACATTGATATCCGCAAGGACCTGTATGCCAACAATGTCTTATCT
NM_001199954.1      TCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTGCTGTCG
NM_001099771.2      TCCATCATGAAGTCTGATGTGGACATCCGCAAAGACCTGTACACCAACACAGTGCTGTCT
NM_001101.3         TCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACAGTGCTGTCT
NM_001277406.1      TCCATCATGAAGTCTGATGTGGACATCCGCAAAGACCTGTACACCAACACAGTGCTGTCT
NM_001615.3         TCCATCATGAAGTGTGACATTGACATCCGTAAGGACTTATATGCCAACAATGTCCTCTCT
NM_001141945.1      AGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCA
NM_001614.3         TCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTGCTGTCG
NM_001017992.3      TCTATCATGAAGTGCGATGTGGATATTCGCAAGGATCTCTATGCCAACACCGTGTTATCT
NM_001100.3         AGCATCATGAAGTGTGACATCGACATCAGGAAGGACCTGTATGCCAACAACGTCATGTCG
NM_001613.2         AGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCA
NM_001277083.1      TCCATCATGAAGTCTGATGTGGACATCCGCAAAGACCTGTACACCAACACAGTGCTGTCT
NM_001083538.1      TCCATCATGAAGTCTGATGTGGACATCCGCAAAGACCTGTACACCAACACAGTGCTGTCT
                    :  **********  ** .* ** ** .* **.**  * ** .* ****. **  * ** 

HsCD00003792        GGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACCGCCCTG
NM_005159.4         GGAGGCACCACTATGTACCCTGGTATTGCTGATCGTATGCAGAAGGAAATCACTGCTCTG
NM_001199954.1      GGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACCGCCCTG
NM_001099771.2      GGCGGCACCACCATGTACCCTGGCATGGCCCACAGAATGCAGAAGGAGATCGCTGCCCTG
NM_001101.3         GGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACTGCCCTG
NM_001277406.1      GGCGGCACCACCATGTACCCTGGCATGGCCCACAGAATGCAGAAGGAGATCGCTGCCCTG
NM_001615.3         GGGGGCACCACCATGTACCCTGGCATTGCTGACAGGATGCAGAAGGAGATCACAGCCCTG
NM_001141945.1      GGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACGGCCCTA
NM_001614.3         GGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACCGCCCTG
NM_001017992.3      GGAGGGAGCACCATGTACCCAGGCATTGCTGACAGGATGCAGAAAGAAATCATAACCCTG
NM_001100.3         GGGGGCACCACGATGTACCCTGGGATCGCTGACCGCATGCAGAAAGAGATCACCGCGCTG
NM_001613.2         GGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACGGCCCTA
NM_001277083.1      GGCGGCACCACCATGTACCCTGGCATGGCCCACAGAATGCAGAAGGAGATCGCTGCCCTG
NM_001083538.1      GGCGGCACCACCATGTACCCTGGCATGGCCCACAGAATGCAGAAGGAGATCGCTGCCCTG
                    ** ** * *** ******** ** ** **  * .* ********.**.***.  .* **.

HsCD00003792        GCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCGGTGTGG
NM_005159.4         GCTCCTAGCACCATGAAGATTAAGATTATTGCTCCCCCTGAGCGTAAATACTCTGTCTGG
NM_001199954.1      GCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCGGTGTGG
NM_001099771.2      GCGCCTAGCATGATGAAGATCAGGATCATTGCTCCTCCCAAGCGCAAGTACTCCGTGTGG
NM_001101.3         GCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGG
NM_001277406.1      GCGCCTAGCATGTTGAAGATCAGGATCATTGCTCCTCCCAAGCGCAAGTACTCCGTGTGG
NM_001615.3         GCCCCCAGCACCATGAAGATCAAGATTATTGCTCCCCCAGAGCGGAAGTACTCAGTCTGG
NM_001141945.1      GCACCCAGCACCATGAAGATCAAGATCATTGCCCCTCCGGAGCGCAAATACTCTGTCTGG
NM_001614.3         GCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCGGTGTGG
NM_001017992.3      GCACCCAGCACCATGAAAATCAAGATCATAGCTCCCCCAGAGCGGAAGTATTCTGTTTGG
NM_001100.3         GCACCCAGCACCATGAAGATCAAGATCATCGCCCCGCCGGAGCGCAAATACTCGGTGTGG
NM_001613.2         GCACCCAGCACCATGAAGATCAAGATCATTGCCCCTCCGGAGCGCAAATACTCTGTCTGG
NM_001277083.1      GCGCCTAGCATGATGAAGATCAGGATCATTGCTCCTCCCAAGCGCAAGTACTCCGTGTGG
NM_001083538.1      GCGCCTAGCATGATGAAGATCAGGATCATTGCTCCTCCCAAGCGCAAGTACTCCGTGTGG
                    ** ** ****  :****.** *.*** ** ** ** ** .**** **.** ** ** ***

HsCD00003792        ATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAG
NM_005159.4         ATTGGGGGCTCCATCCTGGCCTCTCTGTCCACCTTCCAGCAAATGTGGATTAGCAAGCAA
NM_001199954.1      ATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAG
NM_001099771.2      GTCGGTGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAG
NM_001101.3         ATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAG
NM_001277406.1      GTCGGTGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAG
NM_001615.3         ATCGGGGGCTCTATCCTGGCCTCTCTCTCCACCTTCCAGCAGATGTGGATCAGCAAGCCT
NM_001141945.1      ATCGGTGGCTCCATCCTGGCCTCTCTGTCCACCTTCCAGCAGATGTGGATCAGCAAACAG
NM_001614.3         ATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAG
NM_001017992.3      ATTGGGGGCTCCATCCTTGCCAGCCTGTCCACATTCCAGCAGATGTGGATCAGTAAGCAG
NM_001100.3         ATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCACCAAGCAG
NM_001613.2         ATCGGTGGCTCCATCCTGGCCTCTCTGTCCACCTTCCAGCAGATGTGGATCAGCAAACAG
NM_001277083.1      GTCGGTGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAG
NM_001083538.1      GTCGGTGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAG
                    .* ** ***** ***** ***:  ** *****.********.******** *  **.*. 

HsCD00003792        GAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTTG
NM_005159.4         GAGTACGATGAGGCAGGCCCATCCATTGTCCACCGCAAATGCTTCTAA
NM_001199954.1      GAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTAA
NM_001099771.2      GAGTATGATGAGTCAGGCCCCTCCATTGTCCACCGCAAATGCTTGTAG
NM_001101.3         GAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTCTAG
NM_001277406.1      GAGTATGATGAGTCAGGCCCCTCCATTGTCCACCGCAAATGCTTCTAG
NM_001615.3         GAGTATGATGAGGCAGGGCCCTCCATTGTCCACAGGAAGTGCTTCTAA
NM_001141945.1      GAATACGATGAAGCCGGGCCTTCCATTGTCCACCGCAAATGCTTCTAA
NM_001614.3         GAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTAA
NM_001017992.3      GAATATGATGAGGCTGGTCCTCCTATCGTTCACAGAAAATGTTTCTGA
NM_001100.3         GAGTACGACGAGGCCGGCCCTTCCATCGTCCACCGCAAATGCTTCTAG
NM_001613.2         GAATACGATGAAGCCGGGCCTTCCATTGTCCACCGCAAATGCTTCTAA
NM_001277083.1      GAGTATGATGAGTCAGGCCCCTCCATTGTCCACCGCAAATGCTTCTAG
NM_001083538.1      GAGTATGATGAGTCAGGCCCCTCCATTGTCCACCGCAAATGCTTCTAG
                    **.** ** **. * ** **  * ** ** ***.* **.** ** * .

Pathways

Panther : Alzheimer disease-presenilin pathway
Panther : Cadherin signaling pathway
Panther : Cytoskeletal regulation by Rho GTPase
Panther : Huntington disease
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Integrin signalling pathway
Panther : Nicotinic acetylcholine receptor signaling pathway
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Regulation of actin dynamics for phagocytic cup formation
WikiPathway : Focal Adhesion
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Striated Muscle Contraction

Protein

SMART domain : ACTIN : Actin
UniProt : P63261
HPRD : 18598

Clone

Cloning Information : 116867
HIP Master Clone ID : 92713
Original Clone ID : FLH116867.01L

Organism


TAX_ID : 9606
Species Specific ID: 71

Genome

Chromosome : 5
Map Location : 5q11.2
Ensembl : ENSG00000169067

Reagents

Labome : ACTG1-antibody