DNASU Plasmid Repository • 480.965.5697 | Email

PDPK1 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PDPK1
Gene Name:  3-phosphoinositide dependent protein kinase-1
Sequence             
Original Clone ID: FLH164599.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00037925

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1671nts         Open reading frame : 1 to 1671
Reference Sequence Alignment

ATGGCCAGGACCACCAGCCAGCTGTATGACGCCGTGCCCATCCAGTCCAGCGTGGTGTTA
TGTTCCTGCCCATCCCCATCAATGGTGAGGACCCAGACTGAGTCCAGCACGCCCCCTGGC
ATTCCTGGTGGCAGCAGGCAGGGCCCCGCCATGGACGGCACTGCAGCCGAGCCTCGGCCC
GGCGCCGGCTCCCTGCAGCATGCCCAGCCTCCGCCGCAGCCTCGGAAGAAGCGGCCTGAG
GACTTCAAGTTTGGGAAAATCCTTGGGGAAGGCTCTTTTTCCACGGTTGTCCTGGCTCGA
GAACTGGCAACCTCCAGAGAATATGCGATTAAAATTCTGGAGAAGCGACATATCATAAAA
GAGAACAAGGTCCCCTATGTAACCAGAGAGCGGGATGTCATGTCGCGCCTGGATCACCCC
TTCTTTGTTAAGCTTTACTTCACATTTCAGGACGACGAGAAGCTGTATTTCGGCCTTAGT
TATGCCAAAAATGGAGAACTACTTAAATATATTCGCAAAATCGGTTCATTCGATGAGACC
TGTACCCGATTTTACACGGCTGAGATTGTGTCTGCTTTAGAGTACTTGCACGGCAAGGGC
ATCATTCACAGGGACCTTAAACCGGAAAACATTTTGTTAAATGAAGATATGCACATCCAG
ATCACAGATTTTGGAACAGCAAAAGTCTTATCCCCAGAGAGCAAACAAGCCAGGGCCAAC
TCATTCGTGGGAACAGCGCAGTACGTTTCTCCAGAGCTGCTCACGGAGAAGTCCGCCTGT
AAGAGTTCAGACCTTTGGGCTCTTGGATGCATAATATACCAGCTTGTGGCAGGACTCCCA
CCATTCCGAGCTGGAAACGAGTATCTTATATTTCAGAAGATCATTAAGTTGGAATATGAC
TTTCCAGAAAAATTCTTCCCTAAGGCAAGAGACCTCGTGGAGAAACTTTTGGTTTTAGAT
GCCACAAAGCGGTTAGGCTGTGAGGAAATGGAAGGATACGGACCTCTTAAAGCACACCCG
TTCTTCGAGTCCGTCACGTGGGAGAACCTGCACCAGCAGACGCCTCCGAAGCTCACCGCT
TACCTGCCGGCTATGTCGGAAGACGACGAGGACTGCTATGGCAATTATGACAATCTCCTG
AGCCAGTTTGGCTGCATGCAGGTGTCTTCGTCCTCCTCCTCACACTCCCTGTCAGCCTCC
GACACGGGCCTGCCCCAGAGGTCAGGCAGCAACATAGAGCAGTACATTCACGATCTGGAC
TCGAACTCCTTTGAACTGGACTTACAGTTTTCCGAAGATGAGAAGAGGTTGTTGTTGGAG
AAGCAGGCTGGCGGAAACCCTTGGCACCAGTTTGTAGAAAATAATTTAATACTAAAGATG
GGCCCAGTGGATAAGCGGAAGGGTTTATTTGCAAGACGACGACAGCTGTTGCTCACAGAA
GGACCACATTTATATTATGTGGATCCTGTCAACAAAGTTCTGAAAGGTGAAATTCCTTGG
TCACAAGAACTTCGACCAGAGGCCAAGAATTTTAAAACTTTCTTTGTCCACACGCCTAAC
AGGACGTATTATCTGATGGACCCCAGCGGGAACGCACACAAGTGGTGCAGGAAGATCCAG
GAGGTTTGGAGGCAGCGATACCAGAGCCACCCGGACGCCGCTGTGCAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1751
Start on reference sequence 81
Mutations:
None
Discrepancy:
c567t
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PDPK1
Symbol Nomenclature : PDPK1
SYNONYM : PDK1; PDPK2; PRO0461
Designation : 3-phosphoinositide-dependent protein kinase 1|PkB kinase like gene 1
Full Nomenclature : 3-phosphoinositide dependent protein kinase-1
GENEID : 5170
HGNC : 8816
MIM : 605213
Vega : OTTHUMG00000128874
Target GenBank: NM_002613

 

Reference Sequence Alignment

  

HsCD00037925        ATGGCCAGGACCACCAGCCAGCTGTATGACGCCGTGCCCATCCAGTCCAGCGTGGTGTTA
NM_002613.4         ATGGCCAGGACCACCAGCCAGCTGTATGACGCCGTGCCCATCCAGTCCAGCGTGGTGTTA
XM_005255356.1      ------------------------------------------------------------
                                                                                

HsCD00037925        TGTTCCTGCCCATCCCCATCAATGGTGAGGACCCAGACTGAGTCCAGCACGCCCCCTGGC
NM_002613.4         TGTTCCTGCCCATCCCCATCAATGGTGAGGACCCAGACTGAGTCCAGCACGCCCCCTGGC
XM_005255356.1      ---------------------ATGGTGAGGACCCAGACTGAGTCCAGCACGCCCCCTGGC
                                         ***************************************

HsCD00037925        ATTCCTGGTGGCAGCAGGCAGGGCCCCGCCATGGACGGCACTGCAGCCGAGCCTCGGCCC
NM_002613.4         ATTCCTGGTGGCAGCAGGCAGGGCCCCGCCATGGACGGCACTGCAGCCGAGCCTCGGCCC
XM_005255356.1      ATTCCTGGTGGCAGCAGGCAGGGCCCCGCCATGGACGGCACTGCAGCCGAGCCTCGGCCC
                    ************************************************************

HsCD00037925        GGCGCCGGCTCCCTGCAGCATGCCCAGCCTCCGCCGCAGCCTCGGAAGAAGCGGCCTGAG
NM_002613.4         GGCGCCGGCTCCCTGCAGCATGCCCAGCCTCCGCCGCAGCCTCGGAAGAAGCGGCCTGAG
XM_005255356.1      GGCGCCGGCTCCCTGCAGCATGCCCAGCCTCCGCCGCAGCCTCGGAAGAAGCGGCCTGAG
                    ************************************************************

HsCD00037925        GACTTCAAGTTTGGGAAAATCCTTGGGGAAGGCTCTTTTTCCACGGTTGTCCTGGCTCGA
NM_002613.4         GACTTCAAGTTTGGGAAAATCCTTGGGGAAGGCTCTTTTTCCACGGTTGTCCTGGCTCGA
XM_005255356.1      GACTTCAAGTTTGGGAAAATCCTTGGGGAAGGCTCTTTTTCCACGGTTGTCCTGGCTCGA
                    ************************************************************

HsCD00037925        GAACTGGCAACCTCCAGAGAATATGCGATTAAAATTCTGGAGAAGCGACATATCATAAAA
NM_002613.4         GAACTGGCAACCTCCAGAGAATATGCGATTAAAATTCTGGAGAAGCGACATATCATAAAA
XM_005255356.1      GAACTGGCAACCTCCAGAGAATATGCGATTAAAATTCTGGAGAAGCGACATATCATAAAA
                    ************************************************************

HsCD00037925        GAGAACAAGGTCCCCTATGTAACCAGAGAGCGGGATGTCATGTCGCGCCTGGATCACCCC
NM_002613.4         GAGAACAAGGTCCCCTATGTAACCAGAGAGCGGGATGTCATGTCGCGCCTGGATCACCCC
XM_005255356.1      GAGAACAAGGTCCCCTATGTAACCAGAGAGCGGGATGTCATGTCGCGCCTGGATCACCCC
                    ************************************************************

HsCD00037925        TTCTTTGTTAAGCTTTACTTCACATTTCAGGACGACGAGAAGCTGTATTTCGGCCTTAGT
NM_002613.4         TTCTTTGTTAAGCTTTACTTCACATTTCAGGACGACGAGAAGCTGTATTTCGGCCTTAGT
XM_005255356.1      TTCTTTGTTAAGCTTTACTTCACATTTCAGGACGACGAGAAGCTGTATTTCGGCCTTAGT
                    ************************************************************

HsCD00037925        TATGCCAAAAATGGAGAACTACTTAAATATATTCGCAAAATCGGTTCATTCGATGAGACC
NM_002613.4         TATGCCAAAAATGGAGAACTACTTAAATATATTCGCAAAATCGGTTCATTCGATGAGACC
XM_005255356.1      TATGCCAAAAATGGAGAACTACTTAAATATATTCGCAAAATCGGTTCATTCGATGAGACC
                    ************************************************************

HsCD00037925        TGTACCCGATTTTACACGGCTGAGATTGTGTCTGCTTTAGAGTACTTGCACGGCAAGGGC
NM_002613.4         TGTACCCGATTTTACACGGCTGAGATTGTGTCTGCTTTAGAGTACTTGCACGGCAAGGGC
XM_005255356.1      TGTACCCGATTTTACACGGCTGAGATTGTGTCTGCTTTAGAGTACTTGCACGGCAAGGGC
                    ************************************************************

HsCD00037925        ATCATTCACAGGGACCTTAAACCGGAAAACATTTTGTTAAATGAAGATATGCACATCCAG
NM_002613.4         ATCATTCACAGGGACCTTAAACCGGAAAACATTTTGTTAAATGAAGATATGCACATCCAG
XM_005255356.1      ATCATTCACAGGGACCTTAAACCGGAAAACATTTTGTTAAATGAAGATATGCACATCCAG
                    ************************************************************

HsCD00037925        ATCACAGATTTTGGAACAGCAAAAGTCTTATCCCCAGAGAGCAAACAAGCCAGGGCCAAC
NM_002613.4         ATCACAGATTTTGGAACAGCAAAAGTCTTATCCCCAGAGAGCAAACAAGCCAGGGCCAAC
XM_005255356.1      ATCACAGATTTTGGAACAGCAAAAGTCTTATCCCCAGAGAGCAAACAAGCCAGGGCCAAC
                    ************************************************************

HsCD00037925        TCATTCGTGGGAACAGCGCAGTACGTTTCTCCAGAGCTGCTCACGGAGAAGTCCGCCTGT
NM_002613.4         TCATTCGTGGGAACAGCGCAGTACGTTTCTCCAGAGCTGCTCACGGAGAAGTCCGCCTGT
XM_005255356.1      TCATTCGTGGGAACAGCGCAGTACGTTTCTCCAGAGCTGCTCACGGAGAAGTCCGCCTGT
                    ************************************************************

HsCD00037925        AAGAGTTCAGACCTTTGGGCTCTTGGATGCATAATATACCAGCTTGTGGCAGGACTCCCA
NM_002613.4         AAGAGTTCAGACCTTTGGGCTCTTGGATGCATAATATACCAGCTTGTGGCAGGACTCCCA
XM_005255356.1      AAGAGTTCAGACCTTTGGGCTCTTGGATGCATAATATACCAGCTTGTGGCAGGACTCCCA
                    ************************************************************

HsCD00037925        CCATTCCGAGCTGGAAACGAGTATCTTATATTTCAGAAGATCATTAAGTTGGAATATGAC
NM_002613.4         CCATTCCGAGCTGGAAACGAGTATCTTATATTTCAGAAGATCATTAAGTTGGAATATGAC
XM_005255356.1      CCATTCCGAGCTGGAAACGAGTATCTTATATTTCAGAAGATCATTAAGTTGGAATATGAC
                    ************************************************************

HsCD00037925        TTTCCAGAAAAATTCTTCCCTAAGGCAAGAGACCTCGTGGAGAAACTTTTGGTTTTAGAT
NM_002613.4         TTTCCAGAAAAATTCTTCCCTAAGGCAAGAGACCTCGTGGAGAAACTTTTGGTTTTAGAT
XM_005255356.1      TTTCCAGAAAAATTCTTCCCTAAGGCAAGAGACCTCGTGGAGAAACTTTTGGTTTTAGAT
                    ************************************************************

HsCD00037925        GCCACAAAGCGGTTAGGCTGTGAGGAAATGGAAGGATACGGACCTCTTAAAGCACACCCG
NM_002613.4         GCCACAAAGCGGTTAGGCTGTGAGGAAATGGAAGGATACGGACCTCTTAAAGCACACCCG
XM_005255356.1      GCCACAAAGCGGTTAGGCTGTGAGGAAATGGAAGGATACGGACCTCTTAAAGCACACCCG
                    ************************************************************

HsCD00037925        TTCTTCGAGTCCGTCACGTGGGAGAACCTGCACCAGCAGACGCCTCCGAAGCTCACCGCT
NM_002613.4         TTCTTCGAGTCCGTCACGTGGGAGAACCTGCACCAGCAGACGCCTCCGAAGCTCACCGCT
XM_005255356.1      TTCTTCGAGTCCGTCACGTGGGAGAACCTGCACCAGCAGACGCCTCCGAAGCTCACCGCT
                    ************************************************************

HsCD00037925        TACCTGCCGGCTATGTCGGAAGACGACGAGGACTGCTATGGCAATTATGACAATCTCCTG
NM_002613.4         TACCTGCCGGCTATGTCGGAAGACGACGAGGACTGCTATGGCAATTATGACAATCTCCTG
XM_005255356.1      TACCTGCCGGCTATGTCGGAAGACGACGAGGACTGCTATGGCAATTATGACAATCTCCTG
                    ************************************************************

HsCD00037925        AGCCAGTTTGGCTGCATGCAGGTGTCTTCGTCCTCCTCCTCACACTCCCTGTCAGCCTCC
NM_002613.4         AGCCAGTTTGGCTGCATGCAGGTGTCTTCGTCCTCCTCCTCACACTCCCTGTCAGCCTCC
XM_005255356.1      AGCCAGTTTGGCTGCATGCAGGTGTCTTCGTCCTCCTCCTCACACTCCCTGTCAGCCTCC
                    ************************************************************

HsCD00037925        GACACGGGCCTGCCCCAGAGGTCAGGCAGCAACATAGAGCAGTACATTCACGATCTGGAC
NM_002613.4         GACACGGGCCTGCCCCAGAGGTCAGGCAGCAACATAGAGCAGTACATTCACGATCTGGAC
XM_005255356.1      GACACGGGCCTGCCCCAGAGGTCAGGCAGCAACATAGAGCAGTACATTCACGATCTGGAC
                    ************************************************************

HsCD00037925        TCGAACTCCTTTGAACTGGACTTACAGTTTTCCGAAGATGAGAAGAGGTTGTTGTTGGAG
NM_002613.4         TCGAACTCCTTTGAACTGGACTTACAGTTTTCCGAAGATGAGAAGAGGTTGTTGTTGGAG
XM_005255356.1      TCGAACTCCTTTGAACTGGACTTACAGTTTTCCGAAGATGAGAAGAGGTTGTTGTTGGAG
                    ************************************************************

HsCD00037925        AAGCAGGCTGGCGGAAACCCTTGGCACCAGTTTGTAGAAAATAATTTAATACTAAAGATG
NM_002613.4         AAGCAGGCTGGCGGAAACCCTTGGCACCAGTTTGTAGAAAATAATTTAATACTAAAGATG
XM_005255356.1      AAGCAGGCTGGCGGAAACCCTTGGCACCAGTTTGTAGAAAATAATTTAATACTAAAGATG
                    ************************************************************

HsCD00037925        GGCCCAGTGGATAAGCGGAAGGGTTTATTTGCAAGACGACGACAGCTGTTGCTCACAGAA
NM_002613.4         GGCCCAGTGGATAAGCGGAAGGGTTTATTTGCAAGACGACGACAGCTGTTGCTCACAGAA
XM_005255356.1      GGCCCAGTGGATAAGCGGAAGGGTTTATTTGCAAGACGACGACAGCTGTTGCTCACAGAA
                    ************************************************************

HsCD00037925        GGACCACATTTATATTATGTGGATCCTGTCAACAAAGTTCTGAAAGGTGAAATTCCTTGG
NM_002613.4         GGACCACATTTATATTATGTGGATCCTGTCAACAAAGTTCTGAAAGGTGAAATTCCTTGG
XM_005255356.1      GGACCACATTTATATTATGTGGATCCTGTCAACAAAGTTCTGAAAGGTGAAATTCCTTGG
                    ************************************************************

HsCD00037925        TCACAAGAACTTCGACCAGAGGCCAAGAATTTTAAAACTTTCTTTGTCCACACGCCTAAC
NM_002613.4         TCACAAGAACTTCGACCAGAGGCCAAGAATTTTAAAACTTTCTTTGTCCACACGCCTAAC
XM_005255356.1      TCACAAGAACTTCGACCAGAGGCCAAGAATTTTAAAACTTTCTTTGTCCACACGCCTAAC
                    ************************************************************

HsCD00037925        AGGACGTATTATCTGATGGACCCCAGCGGGAACGCACACAAGTGGTGCAGGAAGATCCAG
NM_002613.4         AGGACGTATTATCTGATGGACCCCAGCGGGAACGCACACAAGTGGTGCAGGAAGATCCAG
XM_005255356.1      AGGACGTATTATCTGATGGACCCCAGCGGGAACGCACACAAGTGGTGCAGGAAGATCCAG
                    ************************************************************

HsCD00037925        GAGGTTTGGAGGCAGCGATACCAGAGCCACCCGGACGCCGCTGTGCAGTTG
NM_002613.4         GAGGTTTGGAGGCAGCGATACCAGAGCCACCCGGACGCCGCTGTGCAGTGA
XM_005255356.1      GAGGTTTGGAGGCAGCGATACCAGAGCCACCCGGACGCCGCTGTGCAGTGA
                    ************************************************* .

Pathways

NCI : BCR signaling pathway
NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : Class I PI3K signaling events mediated by Akt
NCI : ErbB1 downstream signaling
NCI : FAS (CD95) signaling pathway
NCI : FGF signaling pathway
NCI : IGF1 pathway
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : Insulin Pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : TGF-beta receptor signaling
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : VEGFR1 specific signals
NCI : mTOR signaling pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : PI3 kinase pathway
Panther : Ras Pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Activation of PKB
Reactome : Adaptive Immune System
Reactome : CD28 co-stimulation
Reactome : CD28 dependent PI3K/Akt signaling
Reactome : CREB phosphorylation through the activation of Ras
Reactome : CTLA4 inhibitory signaling
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Costimulation by the CD28 family
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream TCR signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : FCERI mediated NF-kB activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : G beta:gamma signalling through PI3Kgamma
Reactome : G-protein beta:gamma signalling
Reactome : GAB1 signalosome
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Integrin alphaIIb beta3 signaling
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : PI-3K cascade
Reactome : PI3K Cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation
Reactome : Post NMDA receptor activation events
Reactome : RSK activation
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : TCR signaling
Reactome : Transmission across Chemical Synapses
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Focal Adhesion
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : TCR Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : angiogenesis overview

Clone

Cloning Information : 164599
HIP Master Clone ID : 124231
Original Clone ID : FLH164599.01L

Organism


TAX_ID : 9606
Species Specific ID: 5170

Genome

Chromosome : 16
Map Location : 16p13.3
Ensembl : ENSG00000140992

Reagents

Labome : PDPK1-antibody