DNASU Plasmid Repository • 480.965.5697 | Email

RPS6KA1 (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  RPS6KA1
Gene Name:  ribosomal protein S6 kinase, 90kDa, polypeptide 1
Original Clone ID: FLH164601.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Discrepancy :
No / Yes
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 2208nts         Open reading frame : 1 to 2208
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 2254
Start on reference sequence 47
c1004a,T335K; t1156c

5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : RPS6KA1
Symbol Nomenclature : RPS6KA1
Designation : 90 kDa ribosomal protein S6 kinase 1|MAP kinase-activated protein kinase 1a|MAPK-activated protein kinase 1a|MAPKAP kinase 1a|MAPKAPK-1a|RSK-1|S6K-alpha 1|S6K-alpha-1|dJ590P13.1 (ribosomal protein S6 kinase, 90kD, polypeptide 1)|p90-RSK 1|p90RSK1|p90S6K|ribosomal S6 kinase 1|ribosomal protein S6 kinase alpha 1|ribosomal protein S6 kinase alpha-1
Full Nomenclature : ribosomal protein S6 kinase, 90kDa, polypeptide 1
GENEID : 6195
Locus Tag : RP11-492M19.2
HGNC : 10430
MIM : 601684
Vega : OTTHUMG00000004003
Target GenBank: NM_002953


Reference Sequence Alignment


                                   *:***** *   *:**  .:  .* **  *.  * *: * : * .

                    . *.. *:* . ** ..**: .*.********:  * .:*:. ***            *.

                    *  **** * .*:.**********************************************



































NM_001006665.1      TCCACCACCCTGTGA
NM_002953.3         TCCACCACCCTGTGA
                    ************* .


NCI : FGF signaling pathway
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : VEGFR3 signaling in lymphatic endothelium
NCI : mTOR signaling pathway
Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Reactome : Activated TLR4 signalling
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Axon guidance
Reactome : CREB phosphorylation
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Developmental Biology
Reactome : ERK/MAPK targets
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Immune System
Reactome : Innate Immune System
Reactome : L1CAM interactions
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Post NMDA receptor activation events
Reactome : RSK activation
Reactome : Recycling pathway of L1
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signalling by NGF
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : Transmission across Chemical Synapses
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : Cytoplasmic Ribosomal Proteins
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Kit receptor signaling pathway
WikiPathway : TSH signaling pathway


Cloning Information : 164601
HIP Master Clone ID : 124233
Original Clone ID : FLH164601.01L


TAX_ID : 9606
Species Specific ID: 6195


Chromosome : 1
Map Location : 1p
Ensembl : ENSG00000117676


Labome : p90rsk-antibody