DNASU Plasmid Repository • 480.965.5697 | Email

MAPK6 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAPK6
Gene Name:  mitogen-activated protein kinase 6
Sequence             
Original Clone ID: FLH164606.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00037932

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2166nts         Open reading frame : 1 to 2166
Reference Sequence Alignment

ATGGCAGAGAAATTTGAAAGTCTCATGAACATTCATGGTTTTGATCTGGGTTCTAGGTAT
ATGGACTTAAAACCATTGGGTTGTGGAGGCAATGGCTTGGTTTTTTCTGCTGTAGACAAT
GACTGTGACAAAAGAGTAGCCATCAAGAAAATTGTCCTTACTGATCCCCAGAGTGTCAAA
CATGCTCTACGTGAAATCAAAATTATTAGAAGACTTGACCATGATAACATTGTGAAAGTG
TTTGAGATTCTTGGTCCCAGTGGAAGCCAATTAACAGACGATGTGGGCTCTCTTACGGAA
CTGAACAGTGTTTACATTGTTCAGGAGTACATGGAGACAGACTTGGCTAATGTGCTGGAG
CAGGGCCCTTTACTGGAAGAGCATGCCAGGCTTTTCATGTATCAGCTGCTACGGGGGCTC
AAGTATATTCACTCTGCAAATGTACTGCACAGAGATCTCAAACCAGCTAATCTTTTCATT
AATACGGAAGACTTGGTGCTGAAGATAGGTGACTTTGGTCTTGCACGGATCATGGATCCT
CATTATTCCCATAAGGGTCATCTTTCTGAAGGATTGGTTACTAAATGGTACAGATCTCCA
CGTCTTTTACTTTCTCCTAATAATTATACTAAAGCCATTGACATGTGGGCTGCAGGCTGC
ATCTTTGCTGAAATGCTGACTGGTAAAACCCTTTTTGCAGGTGCACATGAACTTGAACAG
ATGCAGCTGATTTTAGAATCTATTCCTGTTGTACATGAGGAAGATCGTCAGGAGCTTCTC
AGCGTAATTCCAGTTTACATTAGAAATGACATGACTGAGCCACACAAACCTTTAACTCAG
CTGCTTCCAGGAATTAGTCGAGAAGCAGTGGATTTCCTGGAACAAATTTTGACATTTAGC
CCCATGGATCGGTTAACAGCAGAAGAAGCACTCTCCCATCCTTACATGAGCATATATTCT
TTTCCAATGGATGAGCCAATTTCAAGCCATCCTTTTCATATTGAAGATGAAGTTGATGAT
ATTTTGCTTATGGATGAAACTCACAGTCACATTTATAACTGGGAAAGGTATCATGATTGT
CAGTTTTCAGAGCATGATTGGCCTGTACATAACAACTTTGATATTGATGAAGTTCAGCTT
GATCCAAGAGCTCTGTCCGATGTCACTGATGAAGAAGAAGTACAAGTTGATCCCCGAAAA
TATTTGGATGGAGATCGGGAAAAGTATCTGGAGGATCCTGCTTTTGATACCAATTACTCT
ACTGAGCCTTGTTGGCAATACTCAGATCATCATGAAAACAAATATTGTGATCTGGAGTGT
AGCCATACTTGTAACTACAAAACGAGGTCATCATCATATTTAGATAACTTAGTTTGGAGA
GAGAGTGAAGTTAACCATTACTATGAACCCAAGCTTATTATAGATCTTTCCAATTGGAAA
GAACAAAGCAAAGAAAAATCTGATAAGAAAGGCAAATCAAAATGTGAAAGGAATGGATTG
GTTAAAGCCCAGATAGCGCTAGAGGAAGCATCACAGCAACTGGCTGGAAAAGAAAGGGAA
AAGAATCAGGGATTTGATTTTGATTCCTTTATTGCAGGAACTATTCAGCTTAGTTCCCAG
CATGAGCCTACTGATGTTGTTGATAAATTAAATGACTTGAATAGCTCAGTGTCCCAACTA
GAATTGAAAAGTTTGATATCAAAGTCAGTAAGCCAAGAAAAACAGGAAAAAGGAATGGCA
AATCTGGCTCAATTAGAAGCCTTGTACCAGTCTTCTTGGGACAGCCAGTTTGTGAGTGGT
GGGGAGGACTGTTTTTTCATAAATCAGTTTTGTGAGGTAAGGAAGGATGAACAAGTTGAG
AAGGAAAACACTTACACTAGTTACTTGGACAAGTTCTTTAGCAGGAAAGAAGATACTGAA
ATGCTAGAAACTGAGCCAGTAGAGGATGGGAAGCTTGGGGAGAGAGGACATGAGGAAGGA
TTTCTGAACAACAGTGGGGAGTTCCTCTTTAACAAGCAGCTCGAGTCCATAGGCATCCCA
CAGTTTCACAGTCCAGTTGGGTCACCACTTAAGTCAATACAGGCCACATTAACACCTTCT
GCTATGAAATCTTCCCCTCAAATTCCTCATCAAACATACAGCAGCATTCTGAAACATCTG
AACCTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 2644
Start on reference sequence 479
Mutations:
None
Discrepancy:
c868g,L290V
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAPK6
Symbol Nomenclature : MAPK6
SYNONYM : ERK3; HsT17250; PRKM6; p97MAPK
Designation : ERK-3|MAP kinase 6|MAP kinase isoform p97|MAPK 6|extracellular signal-regulated kinase 3|extracellular signal-regulated kinase, p97|p97-MAPK|protein kinase, mitogen-activated 5|protein kinase, mitogen-activated 6
Full Nomenclature : mitogen-activated protein kinase 6
GENEID : 5597
HGNC : 6879
MIM : 602904
Vega : OTTHUMG00000131891
Target GenBank: NM_002748

 

Reference Sequence Alignment

  

HsCD00037932        ATGGCAGAGAAATTTGAAAGTCTCATGAACATTCATGGTTTTGATCTGGGTTCTAGGTAT
XM_005254537.1      ATGGCAGAGAAATTTGAAAGTCTCATGAACATTCATGGTTTTGATCTGGGTTCTAGGTAT
NM_002748.3         ATGGCAGAGAAATTTGAAAGTCTCATGAACATTCATGGTTTTGATCTGGGTTCTAGGTAT
XM_005254538.1      ATGGCAGAGAAATTTGAAAGTCTCATGAACATTCATGGTTTTGATCTGGGTTCTAGGTAT
                    ************************************************************

HsCD00037932        ATGGACTTAAAACCATTGGGTTGTGGAGGCAATGGCTTGGTTTTTTCTGCTGTAGACAAT
XM_005254537.1      ATGGACTTAAAACCATTGGGTTGTGGAGGCAATGGCTTGGTTTTTTCTGCTGTAGACAAT
NM_002748.3         ATGGACTTAAAACCATTGGGTTGTGGAGGCAATGGCTTGGTTTTTTCTGCTGTAGACAAT
XM_005254538.1      ATGGACTTAAAACCATTGGGTTGTGGAGGCAATGGCTTGGTTTTTTCTGCTGTAGACAAT
                    ************************************************************

HsCD00037932        GACTGTGACAAAAGAGTAGCCATCAAGAAAATTGTCCTTACTGATCCCCAGAGTGTCAAA
XM_005254537.1      GACTGTGACAAAAGAGTAGCCATCAAGAAAATTGTCCTTACTGATCCCCAGAGTGTCAAA
NM_002748.3         GACTGTGACAAAAGAGTAGCCATCAAGAAAATTGTCCTTACTGATCCCCAGAGTGTCAAA
XM_005254538.1      GACTGTGACAAAAGAGTAGCCATCAAGAAAATTGTCCTTACTGATCCCCAGAGTGTCAAA
                    ************************************************************

HsCD00037932        CATGCTCTACGTGAAATCAAAATTATTAGAAGACTTGACCATGATAACATTGTGAAAGTG
XM_005254537.1      CATGCTCTACGTGAAATCAAAATTATTAGAAGACTTGACCATGATAACATTGTGAAAGTG
NM_002748.3         CATGCTCTACGTGAAATCAAAATTATTAGAAGACTTGACCATGATAACATTGTGAAAGTG
XM_005254538.1      CATGCTCTACGTGAAATCAAAATTATTAGAAGACTTGACCATGATAACATTGTGAAAGTG
                    ************************************************************

HsCD00037932        TTTGAGATTCTTGGTCCCAGTGGAAGCCAATTAACAGACGATGTGGGCTCTCTTACGGAA
XM_005254537.1      TTTGAGATTCTTGGTCCCAGTGGAAGCCAATTAACAGACGATGTGGGCTCTCTTACGGAA
NM_002748.3         TTTGAGATTCTTGGTCCCAGTGGAAGCCAATTAACAGACGATGTGGGCTCTCTTACGGAA
XM_005254538.1      TTTGAGATTCTTGGTCCCAGTGGAAGCCAATTAACAGACGATGTGGGCTCTCTTACGGAA
                    ************************************************************

HsCD00037932        CTGAACAGTGTTTACATTGTTCAGGAGTACATGGAGACAGACTTGGCTAATGTGCTGGAG
XM_005254537.1      CTGAACAGTGTTTACATTGTTCAGGAGTACATGGAGACAGACTTGGCTAATGTGCTGGAG
NM_002748.3         CTGAACAGTGTTTACATTGTTCAGGAGTACATGGAGACAGACTTGGCTAATGTGCTGGAG
XM_005254538.1      CTGAACAGTGTTTACATTGTTCAGGAGTACATGGAGACAGACTTGGCTAATGTGCTGGAG
                    ************************************************************

HsCD00037932        CAGGGCCCTTTACTGGAAGAGCATGCCAGGCTTTTCATGTATCAGCTGCTACGGGGGCTC
XM_005254537.1      CAGGGCCCTTTACTGGAAGAGCATGCCAGGCTTTTCATGTATCAGCTGCTACGGGGGCTC
NM_002748.3         CAGGGCCCTTTACTGGAAGAGCATGCCAGGCTTTTCATGTATCAGCTGCTACGGGGGCTC
XM_005254538.1      CAGGGCCCTTTACTGGAAGAGCATGCCAGGCTTTTCATGTATCAGCTGCTACGGGGGCTC
                    ************************************************************

HsCD00037932        AAGTATATTCACTCTGCAAATGTACTGCACAGAGATCTCAAACCAGCTAATCTTTTCATT
XM_005254537.1      AAGTATATTCACTCTGCAAATGTACTGCACAGAGATCTCAAACCAGCTAATCTTTTCATT
NM_002748.3         AAGTATATTCACTCTGCAAATGTACTGCACAGAGATCTCAAACCAGCTAATCTTTTCATT
XM_005254538.1      AAGTATATTCACTCTGCAAATGTACTGCACAGAGATCTCAAACCAGCTAATCTTTTCATT
                    ************************************************************

HsCD00037932        AATACGGAAGACTTGGTGCTGAAGATAGGTGACTTTGGTCTTGCACGGATCATGGATCCT
XM_005254537.1      AATACGGAAGACTTGGTGCTGAAGATAGGTGACTTTGGTCTTGCACGGATCATGGATCCT
NM_002748.3         AATACGGAAGACTTGGTGCTGAAGATAGGTGACTTTGGTCTTGCACGGATCATGGATCCT
XM_005254538.1      AATACGGAAGACTTGGTGCTGAAGATAGGTGACTTTGGTCTTGCACGGATCATGGATCCT
                    ************************************************************

HsCD00037932        CATTATTCCCATAAGGGTCATCTTTCTGAAGGATTGGTTACTAAATGGTACAGATCTCCA
XM_005254537.1      CATTATTCCCATAAGGGTCATCTTTCTGAAGGATTGGTTACTAAATGGTACAGATCTCCA
NM_002748.3         CATTATTCCCATAAGGGTCATCTTTCTGAAGGATTGGTTACTAAATGGTACAGATCTCCA
XM_005254538.1      CATTATTCCCATAAGGGTCATCTTTCTGAAGGATTGGTTACTAAATGGTACAGATCTCCA
                    ************************************************************

HsCD00037932        CGTCTTTTACTTTCTCCTAATAATTATACTAAAGCCATTGACATGTGGGCTGCAGGCTGC
XM_005254537.1      CGTCTTTTACTTTCTCCTAATAATTATACTAAAGCCATTGACATGTGGGCTGCAGGCTGC
NM_002748.3         CGTCTTTTACTTTCTCCTAATAATTATACTAAAGCCATTGACATGTGGGCTGCAGGCTGC
XM_005254538.1      CGTCTTTTACTTTCTCCTAATAATTATACTAAAGCCATTGACATGTGGGCTGCAGGCTGC
                    ************************************************************

HsCD00037932        ATCTTTGCTGAAATGCTGACTGGTAAAACCCTTTTTGCAGGTGCACATGAACTTGAACAG
XM_005254537.1      ATCTTTGCTGAAATGCTGACTGGTAAAACCCTTTTTGCAGGTGCACATGAACTTGAACAG
NM_002748.3         ATCTTTGCTGAAATGCTGACTGGTAAAACCCTTTTTGCAGGTGCACATGAACTTGAACAG
XM_005254538.1      ATCTTTGCTGAAATGCTGACTGGTAAAACCCTTTTTGCAGGTGCACATGAACTTGAACAG
                    ************************************************************

HsCD00037932        ATGCAGCTGATTTTAGAATCTATTCCTGTTGTACATGAGGAAGATCGTCAGGAGCTTCTC
XM_005254537.1      ATGCAGCTGATTTTAGAATCTATTCCTGTTGTACATGAGGAAGATCGTCAGGAGCTTCTC
NM_002748.3         ATGCAGCTGATTTTAGAATCTATTCCTGTTGTACATGAGGAAGATCGTCAGGAGCTTCTC
XM_005254538.1      ATGCAGCTGATTTTAGAATCTATTCCTGTTGTACATGAGGAAGATCGTCAGGAGCTTCTC
                    ************************************************************

HsCD00037932        AGCGTAATTCCAGTTTACATTAGAAATGACATGACTGAGCCACACAAACCTTTAACTCAG
XM_005254537.1      AGCGTAATTCCAGTTTACATTAGAAATGACATGACTGAGCCACACAAACCTTTAACTCAG
NM_002748.3         AGCGTAATTCCAGTTTACATTAGAAATGACATGACTGAGCCACACAAACCTTTAACTCAG
XM_005254538.1      AGCGTAATTCCAGTTTACATTAGAAATGACATGACTGAGCCACACAAACCTTTAACTCAG
                    ************************************************************

HsCD00037932        CTGCTTCCAGGAATTAGTCGAGAAGCAGTGGATTTCCTGGAACAAATTTTGACATTTAGC
XM_005254537.1      CTGCTTCCAGGAATTAGTCGAGAAGCACTGGATTTCCTGGAACAAATTTTGACATTTAGC
NM_002748.3         CTGCTTCCAGGAATTAGTCGAGAAGCACTGGATTTCCTGGAACAAATTTTGACATTTAGC
XM_005254538.1      CTGCTTCCAGGAATTAGTCGAGAAGCACTGGATTTCCTGGAACAAATTTTGACATTTAGC
                    *************************** ********************************

HsCD00037932        CCCATGGATCGGTTAACAGCAGAAGAAGCACTCTCCCATCCTTACATGAGCATATATTCT
XM_005254537.1      CCCATGGATCGGTTAACAGCAGAAGAAGCACTCTCCCATCCTTACATGAGCATATATTCT
NM_002748.3         CCCATGGATCGGTTAACAGCAGAAGAAGCACTCTCCCATCCTTACATGAGCATATATTCT
XM_005254538.1      CCCATGGATCGGTTAACAGCAGAAGAAGCACTCTCCCATCCTTACATGAGCATATATTCT
                    ************************************************************

HsCD00037932        TTTCCAATGGATGAGCCAATTTCAAGCCATCCTTTTCATATTGAAGATGAAGTTGATGAT
XM_005254537.1      TTTCCAATGGATGAGCCAATTTCAAGCCATCCTTTTCATATTGAAGATGAAGTTGATGAT
NM_002748.3         TTTCCAATGGATGAGCCAATTTCAAGCCATCCTTTTCATATTGAAGATGAAGTTGATGAT
XM_005254538.1      TTTCCAATGGATGAGCCAATTTCAAGCCATCCTTTTCATATTGAAGATGAAGTTGATGAT
                    ************************************************************

HsCD00037932        ATTTTGCTTATGGATGAAACTCACAGTCACATTTATAACTGGGAAAGGTATCATGATTGT
XM_005254537.1      ATTTTGCTTATGGATGAAACTCACAGTCACATTTATAACTGGGAAAGGTATCATGATTGT
NM_002748.3         ATTTTGCTTATGGATGAAACTCACAGTCACATTTATAACTGGGAAAGGTATCATGATTGT
XM_005254538.1      ATTTTGCTTATGGATGAAACTCACAGTCACATTTATAACTGGGAAAGGTATCATGATTGT
                    ************************************************************

HsCD00037932        CAGTTTTCAGAGCATGATTGGCCTGTACATAACAACTTTGATATTGATGAAGTTCAGCTT
XM_005254537.1      CAGTTTTCAGAGCATGATTGGCCTGTACATAACAACTTTGATATTGATGAAGTTCAGCTT
NM_002748.3         CAGTTTTCAGAGCATGATTGGCCTGTACATAACAACTTTGATATTGATGAAGTTCAGCTT
XM_005254538.1      CAGTTTTCAGAGCATGATTGGCCTGTACATAACAACTTTGATATTGATGAAGTTCAGCTT
                    ************************************************************

HsCD00037932        GATCCAAGAGCTCTGTCCGATGTCACTGATGAAGAAGAAGTACAAGTTGATCCCCGAAAA
XM_005254537.1      GATCCAAGAGCTCTGTCCGATGTCACTGATGAAGAAGAAGTACAAGTTGATCCCCGAAAA
NM_002748.3         GATCCAAGAGCTCTGTCCGATGTCACTGATGAAGAAGAAGTACAAGTTGATCCCCGAAAA
XM_005254538.1      GATCCAAGAGCTCTGTCCGATGTCACTGATGAAGAAGAAGTACAAGTTGATCCCCGAAAA
                    ************************************************************

HsCD00037932        TATTTGGATGGAGATCGGGAAAAGTATCTGGAGGATCCTGCTTTTGATACCAATTACTCT
XM_005254537.1      TATTTGGATGGAGATCGGGAAAAGTATCTGGAGGATCCTGCTTTTGATACCAATTACTCT
NM_002748.3         TATTTGGATGGAGATCGGGAAAAGTATCTGGAGGATCCTGCTTTTGATACCAATTACTCT
XM_005254538.1      TATTTGGATGGAGATCGGGAAAAGTATCTGGAGGATCCTGCTTTTGATACCAATTACTCT
                    ************************************************************

HsCD00037932        ACTGAGCCTTGTTGGCAATACTCAGATCATCATGAAAACAAATATTGTGATCTGGAGTGT
XM_005254537.1      ACTGAGCCTTGTTGGCAATACTCAGATCATCATGAAAACAAATATTGTGATCTGGAGTGT
NM_002748.3         ACTGAGCCTTGTTGGCAATACTCAGATCATCATGAAAACAAATATTGTGATCTGGAGTGT
XM_005254538.1      ACTGAGCCTTGTTGGCAATACTCAGATCATCATGAAAACAAATATTGTGATCTGGAGTGT
                    ************************************************************

HsCD00037932        AGCCATACTTGTAACTACAAAACGAGGTCATCATCATATTTAGATAACTTAGTTTGGAGA
XM_005254537.1      AGCCATACTTGTAACTACAAAACGAGGTCATCATCATATTTAGATAACTTAGTTTGGAGA
NM_002748.3         AGCCATACTTGTAACTACAAAACGAGGTCATCATCATATTTAGATAACTTAGTTTGGAGA
XM_005254538.1      AGCCATACTTGTAACTACAAAACGAGGTCATCATCATATTTAGATAACTTAGTTTGGAGA
                    ************************************************************

HsCD00037932        GAGAGTGAAGTTAACCATTACTATGAACCCAAGCTTATTATAGATCTTTCCAATTGGAAA
XM_005254537.1      GAGAGTGAAGTTAACCATTACTATGAACCCAAGCTTATTATAGATCTTTCCAATTGGAAA
NM_002748.3         GAGAGTGAAGTTAACCATTACTATGAACCCAAGCTTATTATAGATCTTTCCAATTGGAAA
XM_005254538.1      GAGAGTGAAGTTAACCATTACTATGAACCCAAGCTTATTATAGATCTTTCCAATTGGAAA
                    ************************************************************

HsCD00037932        GAACAAAGCAAAGAAAAATCTGATAAGAAAGGCAAATCAAAATGTGAAAGGAATGGATTG
XM_005254537.1      GAACAAAGCAAAGAAAAATCTGATAAGAAAGGCAAATCAAAATGTGAAAGGAATGGATTG
NM_002748.3         GAACAAAGCAAAGAAAAATCTGATAAGAAAGGCAAATCAAAATGTGAAAGGAATGGATTG
XM_005254538.1      GAACAAAGCAAAGAAAAATCTGATAAGAAAGGCAAATCAAAATGTGAAAGGAATGGATTG
                    ************************************************************

HsCD00037932        GTTAAAGCCCAGATAGCGCTAGAGGAAGCATCACAGCAACTGGCTGGAAAAGAAAGGGAA
XM_005254537.1      GTTAAAGCCCAGATAGCGCTAGAGGAAGCATCACAGCAACTGGCTGGAAAAGAAAGGGAA
NM_002748.3         GTTAAAGCCCAGATAGCGCTAGAGGAAGCATCACAGCAACTGGCTGGAAAAGAAAGGGAA
XM_005254538.1      GTTAAAGCCCAGATAGCGCTAGAGGAAGCATCACAGCAACTGGCTGGAAAAGAAAGGGAA
                    ************************************************************

HsCD00037932        AAGAATCAGGGATTTGATTTTGATTCCTTTATTGCAGGAACTATTCAGCTTAGTTCCCAG
XM_005254537.1      AAGAATCAGGGATTTGATTTTGATTCCTTTATTGCAGGAACTATTCAGCTTAGTTCCCAG
NM_002748.3         AAGAATCAGGGATTTGATTTTGATTCCTTTATTGCAGGAACTATTCAGCTTAGTTCCCAG
XM_005254538.1      AAGAATCAGGGATTTGATTTTGATTCCTTTATTGCAGGAACTATTCAGCTTAGTTCCCAG
                    ************************************************************

HsCD00037932        CATGAGCCTACTGATGTTGTTGATAAATTAAATGACTTGAATAGCTCAGTGTCCCAACTA
XM_005254537.1      CATGAGCCTACTGATGTTGTTGATAAATTAAATGACTTGAATAGCTCAGTGTCCCAACTA
NM_002748.3         CATGAGCCTACTGATGTTGTTGATAAATTAAATGACTTGAATAGCTCAGTGTCCCAACTA
XM_005254538.1      CATGAGCCTACTGATGTTGTTGATAAATTAAATGACTTGAATAGCTCAGTGTCCCAACTA
                    ************************************************************

HsCD00037932        GAATTGAAAAGTTTGATATCAAAGTCAGTAAGCCAAGAAAAACAGGAAAAAGGAATGGCA
XM_005254537.1      GAATTGAAAAGTTTGATATCAAAGTCAGTAAGCCAAGAAAAACAGGAAAAAGGAATGGCA
NM_002748.3         GAATTGAAAAGTTTGATATCAAAGTCAGTAAGCCAAGAAAAACAGGAAAAAGGAATGGCA
XM_005254538.1      GAATTGAAAAGTTTGATATCAAAGTCAGTAAGCCAAGAAAAACAGGAAAAAGGAATGGCA
                    ************************************************************

HsCD00037932        AATCTGGCTCAATTAGAAGCCTTGTACCAGTCTTCTTGGGACAGCCAGTTTGTGAGTGGT
XM_005254537.1      AATCTGGCTCAATTAGAAGCCTTGTACCAGTCTTCTTGGGACAGCCAGTTTGTGAGTGGT
NM_002748.3         AATCTGGCTCAATTAGAAGCCTTGTACCAGTCTTCTTGGGACAGCCAGTTTGTGAGTGGT
XM_005254538.1      AATCTGGCTCAATTAGAAGCCTTGTACCAGTCTTCTTGGGACAGCCAGTTTGTGAGTGGT
                    ************************************************************

HsCD00037932        GGGGAGGACTGTTTTTTCATAAATCAGTTTTGTGAGGTAAGGAAGGATGAACAAGTTGAG
XM_005254537.1      GGGGAGGACTGTTTTTTCATAAATCAGTTTTGTGAGGTAAGGAAGGATGAACAAGTTGAG
NM_002748.3         GGGGAGGACTGTTTTTTCATAAATCAGTTTTGTGAGGTAAGGAAGGATGAACAAGTTGAG
XM_005254538.1      GGGGAGGACTGTTTTTTCATAAATCAGTTTTGTGAGGTAAGGAAGGATGAACAAGTTGAG
                    ************************************************************

HsCD00037932        AAGGAAAACACTTACACTAGTTACTTGGACAAGTTCTTTAGCAGGAAAGAAGATACTGAA
XM_005254537.1      AAGGAAAACACTTACACTAGTTACTTGGACAAGTTCTTTAGCAGGAAAGAAGATACTGAA
NM_002748.3         AAGGAAAACACTTACACTAGTTACTTGGACAAGTTCTTTAGCAGGAAAGAAGATACTGAA
XM_005254538.1      AAGGAAAACACTTACACTAGTTACTTGGACAAGTTCTTTAGCAGGAAAGAAGATACTGAA
                    ************************************************************

HsCD00037932        ATGCTAGAAACTGAGCCAGTAGAGGATGGGAAGCTTGGGGAGAGAGGACATGAGGAAGGA
XM_005254537.1      ATGCTAGAAACTGAGCCAGTAGAGGATGGGAAGCTTGGGGAGAGAGGACATGAGGAAGGA
NM_002748.3         ATGCTAGAAACTGAGCCAGTAGAGGATGGGAAGCTTGGGGAGAGAGGACATGAGGAAGGA
XM_005254538.1      ATGCTAGAAACTGAGCCAGTAGAGGATGGGAAGCTTGGGGAGAGAGGACATGAGGAAGGA
                    ************************************************************

HsCD00037932        TTTCTGAACAACAGTGGGGAGTTCCTCTTTAACAAGCAGCTCGAGTCCATAGGCATCCCA
XM_005254537.1      TTTCTGAACAACAGTGGGGAGTTCCTCTTTAACAAGCAGCTCGAGTCCATAGGCATCCCA
NM_002748.3         TTTCTGAACAACAGTGGGGAGTTCCTCTTTAACAAGCAGCTCGAGTCCATAGGCATCCCA
XM_005254538.1      TTTCTGAACAACAGTGGGGAGTTCCTCTTTAACAAGCAGCTCGAGTCCATAGGCATCCCA
                    ************************************************************

HsCD00037932        CAGTTTCACAGTCCAGTTGGGTCACCACTTAAGTCAATACAGGCCACATTAACACCTTCT
XM_005254537.1      CAGTTTCACAGTCCAGTTGGGTCACCACTTAAGTCAATACAGGCCACATTAACACCTTCT
NM_002748.3         CAGTTTCACAGTCCAGTTGGGTCACCACTTAAGTCAATACAGGCCACATTAACACCTTCT
XM_005254538.1      CAGTTTCACAGTCCAGTTGGGTCACCACTTAAGTCAATACAGGCCACATTAACACCTTCT
                    ************************************************************

HsCD00037932        GCTATGAAATCTTCCCCTCAAATTCCTCATCAAACATACAGCAGCATTCTGAAACATCTG
XM_005254537.1      GCTATGAAATCTTCCCCTCAAATTCCTCATCAAACATACAGCAGCATTCTGAAACATCTG
NM_002748.3         GCTATGAAATCTTCCCCTCAAATTCCTCATCAAACATACAGCAGCATTCTGAAACATCTG
XM_005254538.1      GCTATGAAATCTTCCCCTCAAATTCCTCATCAAACATACAGCAGCATTCTGAAACATCTG
                    ************************************************************

HsCD00037932        AACCTG
XM_005254537.1      AACTAA
NM_002748.3         AACTAA
XM_005254538.1      AACTAA
                    *** :.

Pathways

Panther : Alzheimer disease-amyloid secretase pathway
Panther : Integrin signalling pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : MAPK signaling pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Signal Transduction of S1P Receptor

Clone

Cloning Information : 164606
HIP Master Clone ID : 124238
Original Clone ID : FLH164606.01L

Organism


TAX_ID : 9606
Species Specific ID: 5597

Genome

Chromosome : 15
Map Location : 15q21
Ensembl : ENSG00000069956

Reagents

Labome : MAPK6-antibody