DNASU Plasmid Repository • 480.965.5697 | Email

CAMK2B (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CAMK2B
Gene Name:  calcium/calmodulin-dependent protein kinase II beta
Sequence             
Original Clone ID: FLH164612.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00037938

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1512nts         Open reading frame : 1 to 1512
Reference Sequence Alignment

ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAGCAGCCAAGAGTTTA
CTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAAAACAGTGCAGCC
GCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTGGAGTCTTCTGACAGTGCCAAT
ACCACCATAGAGGATGAAGACGCTAAAGCCCGGAAGCAGGAGATCATTAAGACCACGGAG
CAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATCTGTGACCCA
GGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATGGACTTCCAC
AGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACGACCATCCTG
AACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATCCGGCTCACG
CAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACCCGCGTGTGG
CACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCGCCTGTGGCC
CCGCTGCAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1675
Start on reference sequence 47
Mutations:
None
Discrepancy:
del@946,72; del@1134,45
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CAMK2B
Symbol Nomenclature : CAMK2B
SYNONYM : CAM2; CAMK2; CAMKB
Designation : CaM kinase II beta subunit|CaM-kinase II beta chain|caMK-II subunit beta|calcium/calmodulin-dependent protein kinase type II subunit beta|proline rich calmodulin-dependent protein kinase
Full Nomenclature : calcium/calmodulin-dependent protein kinase II beta
GENEID : 816
HGNC : 1461
MIM : 607707
Vega : OTTHUMG00000023491
Target GenBank: NM_001220

 

Reference Sequence Alignment

  

HsCD00037938        ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
NM_001220.4         ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
XM_005249861.1      ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
NM_172080.2         ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
NM_172078.2         ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
NM_172081.2         ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
NM_172079.2         ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
NM_172083.2         ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
                    ************************************************************

HsCD00037938        GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
NM_001220.4         GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
XM_005249861.1      GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
NM_172080.2         GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
NM_172078.2         GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
NM_172081.2         GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
NM_172079.2         GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
NM_172083.2         GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
                    ************************************************************

HsCD00037938        GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
NM_001220.4         GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
XM_005249861.1      GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
NM_172080.2         GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
NM_172078.2         GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
NM_172081.2         GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
NM_172079.2         GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
NM_172083.2         GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
                    ************************************************************

HsCD00037938        GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
NM_001220.4         GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
XM_005249861.1      GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
NM_172080.2         GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
NM_172078.2         GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
NM_172081.2         GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
NM_172079.2         GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
NM_172083.2         GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
                    ************************************************************

HsCD00037938        TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
NM_001220.4         TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
XM_005249861.1      TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
NM_172080.2         TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
NM_172078.2         TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
NM_172081.2         TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
NM_172079.2         TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
NM_172083.2         TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
                    ************************************************************

HsCD00037938        GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
NM_001220.4         GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
XM_005249861.1      GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
NM_172080.2         GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
NM_172078.2         GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
NM_172081.2         GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
NM_172079.2         GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
NM_172083.2         GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
                    ************************************************************

HsCD00037938        CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
NM_001220.4         CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
XM_005249861.1      CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
NM_172080.2         CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
NM_172078.2         CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
NM_172081.2         CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
NM_172079.2         CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
NM_172083.2         CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
                    ************************************************************

HsCD00037938        AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
NM_001220.4         AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
XM_005249861.1      AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
NM_172080.2         AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
NM_172078.2         AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
NM_172081.2         AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
NM_172079.2         AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
NM_172083.2         AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
                    ************************************************************

HsCD00037938        GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
NM_001220.4         GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
XM_005249861.1      GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
NM_172080.2         GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
NM_172078.2         GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
NM_172081.2         GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
NM_172079.2         GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
NM_172083.2         GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
                    ************************************************************

HsCD00037938        CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
NM_001220.4         CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
XM_005249861.1      CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
NM_172080.2         CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
NM_172078.2         CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
NM_172081.2         CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
NM_172079.2         CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
NM_172083.2         CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
                    ************************************************************

HsCD00037938        GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
NM_001220.4         GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
XM_005249861.1      GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
NM_172080.2         GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
NM_172078.2         GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
NM_172081.2         GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
NM_172079.2         GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
NM_172083.2         GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
                    ************************************************************

HsCD00037938        AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
NM_001220.4         AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
XM_005249861.1      AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
NM_172080.2         AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
NM_172078.2         AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
NM_172081.2         AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
NM_172079.2         AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
NM_172083.2         AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
                    ************************************************************

HsCD00037938        GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
NM_001220.4         GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
XM_005249861.1      GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
NM_172080.2         GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
NM_172078.2         GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
NM_172081.2         GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
NM_172079.2         GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
NM_172083.2         GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
                    ************************************************************

HsCD00037938        ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
NM_001220.4         ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
XM_005249861.1      ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
NM_172080.2         ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
NM_172078.2         ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
NM_172081.2         ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
NM_172079.2         ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
NM_172083.2         ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
                    ************************************************************

HsCD00037938        ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
NM_001220.4         ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
XM_005249861.1      ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
NM_172080.2         ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
NM_172078.2         ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
NM_172081.2         ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
NM_172079.2         ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
NM_172083.2         ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
                    ************************************************************

HsCD00037938        AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAG--------------
NM_001220.4         AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAGTGGGCAGACAGACC
XM_005249861.1      AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAGTGGGCAGACAGACC
NM_172080.2         AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAG--------------
NM_172078.2         AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAGTGGGCAGACAGACC
NM_172081.2         AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAG--------------
NM_172079.2         AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAG--------------
NM_172083.2         AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAG--------------
                    **********************************************              

HsCD00037938        ----------------------------------------------------------CA
NM_001220.4         ACCGCTCCGGCCACAATGTCCACCGCGGCCTCCGGCACCACCATGGGGCTGGTGGAACAA
XM_005249861.1      ACCGCTCCGGCCACAATGTCCACCGCGGCCTCCGGCACCACCATGGGGCTGGTGGAACAA
NM_172080.2         ------------------------------------------------------------
NM_172078.2         ACCGCTCCGGCCACAATGTCCACCGCGGCCTCCGGCACCACCATGGGGCTGGTGGAACAA
NM_172081.2         ----------------------------------------------------------CA
NM_172079.2         ----------------------------------------------------------CA
NM_172083.2         ----------------------------------------------------------CA
                                                                                

HsCD00037938        GCCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAA
NM_001220.4         GCCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAA
XM_005249861.1      GCCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAA
NM_172080.2         -CCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAA
NM_172078.2         GCCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAA
NM_172081.2         GCCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAA
NM_172079.2         GCCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAA
NM_172083.2         GCCAAGAGTTTACTCAACAAGAAAGCAGATG-----------------------------
                     ******************************                             

HsCD00037938        AACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTG---------
NM_001220.4         AACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTGGAGCCTCAA
XM_005249861.1      AACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTGGAGCCTCAA
NM_172080.2         AACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTGGAGCCTCAA
NM_172078.2         AACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTGGAGCCTCAA
NM_172081.2         AACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTG---------
NM_172079.2         AACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTGGAGCCTCAA
NM_172083.2         -------------------------------------------GAGTCAAG---------
                                                                .* *.:*         

HsCD00037938        ------------------------------------GAGTCTTCTGACAGTGCCAATACC
NM_001220.4         ACCACCGTCATCCATAACCCAGTGGACGGGATTAAGGAGTCTTCTGACAGTGCCAATACC
XM_005249861.1      ACCACCGTCATCCATAACCCAGTGGACGGGATTAAGGAGTCTTCTGACAGTGCCAATACC
NM_172080.2         ACCACCGTCATCCATAACCCAGTGGACGGGATTAAGGAGTCTTCTGACAGTGCCAATACC
NM_172078.2         ACCACCGTCATCCATAACCCAGTGGACGGGATTAAGGAGTCTTCTGACAGTGCCAATACC
NM_172081.2         ------------------------------------GAGTCTTCTGACAGTGCCAATACC
NM_172079.2         ACCACCGTCATCCATAACCCAGTGGACGGGATTAAGGAGTCTTCTGACAGTGCCAATACC
NM_172083.2         ------------------------------------GAGTCTTCTGACAGTGCCAATACC
                                                        ************************

HsCD00037938        ACCATAGAGGATGAAGACGCTAAAGCCCGGAAG---------------------------
NM_001220.4         ACCATAGAGGATGAAGACGCTAAAGCCCCCAGGGTCCCCGACATCCTGAGCTCAGTGAGG
XM_005249861.1      ACCATAGAGGATGAAGACGCTAAAGCCCGGAAG---------------------------
NM_172080.2         ACCATAGAGGATGAAGACGCTAAAGCCCGGAAG---------------------------
NM_172078.2         ACCATAGAGGATGAAGACGCTAAAGCCCGGAAG---------------------------
NM_172081.2         ACCATAGAGGATGAAGACGCTAAAGCCCGGAAG---------------------------
NM_172079.2         ACCATAGAGGATGAAGACGCTAAAGCCCGGAAG---------------------------
NM_172083.2         ACCATAGAGGATGAAGACGCTAAAGCCCGGAAG---------------------------
                    ****************************  *.*                           

HsCD00037938        ------------------------------------------------------------
NM_001220.4         AGGGGCTCGGGAGCCCCAGAAGCCGAGGGGCCCCTGCCCTGCCCATCTCCGGCTCCCTTT
XM_005249861.1      ------------------------------------------------------------
NM_172080.2         ------------------------------------------------------------
NM_172078.2         ------------------------------------------------------------
NM_172081.2         ------------------------------------------------------------
NM_172079.2         ------------------------------------------------------------
NM_172083.2         ------------------------------------------------------------
                                                                                

HsCD00037938        ------------------------------------------------------------
NM_001220.4         AGCCCCCTGCCAGCCCCATCCCCCAGGATCTCTGACATCCTGAACTCTGTGAGAAGGGGT
XM_005249861.1      ------------------------------------------------------------
NM_172080.2         ------------------------------------------------------------
NM_172078.2         ------------------------------------------------------------
NM_172081.2         ------------------------------------------------------------
NM_172079.2         ------------------------------------------------------------
NM_172083.2         ------------------------------------------------------------
                                                                                

HsCD00037938        ------------------------------------------------------------
NM_001220.4         TCAGGAACCCCAGAAGCCGAGGGCCCCCTCTCAGCGGGGCCCCCGCCCTGCCTGTCTCCG
XM_005249861.1      ------------------------------------------------------------
NM_172080.2         ------------------------------------------------------------
NM_172078.2         ------------------------------------------------------------
NM_172081.2         ------------------------------------------------------------
NM_172079.2         ------------------------------------------------------------
NM_172083.2         ------------------------------------------------------------
                                                                                

HsCD00037938        ------------------------------------------------------------
NM_001220.4         GCTCTCCTAGGCCCCCTGTCCTCCCCGTCCCCCAGGATCTCTGACATCCTGAACTCTGTG
XM_005249861.1      ------------------------------------------------------------
NM_172080.2         ------------------------------------------------------------
NM_172078.2         ------------------------------------------------------------
NM_172081.2         ------------------------------------------------------------
NM_172079.2         ------------------------------------------------------------
NM_172083.2         ------------------------------------------------------------
                                                                                

HsCD00037938        ------------------------------------------------------------
NM_001220.4         AGGAGGGGCTCAGGGACCCCAGAAGCCGAGGGCCCCTCGCCAGTGGGGCCCCCGCCCTGC
XM_005249861.1      ------------------------------------------------------------
NM_172080.2         ------------------------------------------------------------
NM_172078.2         ------------------------------------------------------------
NM_172081.2         ------------------------------------------------------------
NM_172079.2         ------------------------------------------------------------
NM_172083.2         ------------------------------------------------------------
                                                                                

HsCD00037938        ---------------------------------------------CAGGAGATCATTAAG
NM_001220.4         CCATCTCCGACTATCCCTGGCCCCCTGCCCACCCCATCCCGGAAGCAGGAGATCATTAAG
XM_005249861.1      ---------------------------------------------CAGGAGATCATTAAG
NM_172080.2         ---------------------------------------------CAGGAGATCATTAAG
NM_172078.2         ---------------------------------------------CAGGAGATCATTAAG
NM_172081.2         ---------------------------------------------CAGGAGATCATTAAG
NM_172079.2         ---------------------------------------------CAGGAGATCATTAAG
NM_172083.2         ---------------------------------------------CAGGAGATCATTAAG
                                                                 ***************

HsCD00037938        ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
NM_001220.4         ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
XM_005249861.1      ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
NM_172080.2         ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
NM_172078.2         ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
NM_172081.2         ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
NM_172079.2         ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
NM_172083.2         ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
                    ************************************************************

HsCD00037938        TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
NM_001220.4         TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
XM_005249861.1      TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
NM_172080.2         TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
NM_172078.2         TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
NM_172081.2         TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
NM_172079.2         TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
NM_172083.2         TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
                    ************************************************************

HsCD00037938        GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
NM_001220.4         GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
XM_005249861.1      GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
NM_172080.2         GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
NM_172078.2         GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
NM_172081.2         GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
NM_172079.2         GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
NM_172083.2         GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
                    ************************************************************

HsCD00037938        ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
NM_001220.4         ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
XM_005249861.1      ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
NM_172080.2         ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
NM_172078.2         ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
NM_172081.2         ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
NM_172079.2         ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
NM_172083.2         ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
                    ************************************************************

HsCD00037938        CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
NM_001220.4         CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
XM_005249861.1      CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
NM_172080.2         CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
NM_172078.2         CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
NM_172081.2         CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
NM_172079.2         CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
NM_172083.2         CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
                    ************************************************************

HsCD00037938        CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
NM_001220.4         CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
XM_005249861.1      CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
NM_172080.2         CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
NM_172078.2         CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
NM_172081.2         CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
NM_172079.2         CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
NM_172083.2         CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
                    ************************************************************

HsCD00037938        CCTGTGGCCCCGCTGCAGTTG
NM_001220.4         CCTGTGGCCCCGCTGCAGTGA
XM_005249861.1      CCTGTGGCCCCGCTGCAGTGA
NM_172080.2         CCTGTGGCCCCGCTGCAGTGA
NM_172078.2         CCTGTGGCCCCGCTGCAGTGA
NM_172081.2         CCTGTGGCCCCGCTGCAGTGA
NM_172079.2         CCTGTGGCCCCGCTGCAGTGA
NM_172083.2         CCTGTGGCCCCGCTGCAGTGA
                    ******************* .

Pathways

NCI : IFN-gamma pathway
NCI : Regulation of Ras family activation
NCI : p38 MAPK signaling pathway
Panther : Ionotropic glutamate receptor pathway
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : CREB phosphorylation through the activation of CaMKII
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Cytokine Signaling in Immune system
Reactome : Glutamate Binding, Activation of AMPA Receptors and Synaptic Plasticity
Reactome : HSF1-dependent transactivation
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon gamma signaling
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Post NMDA receptor activation events
Reactome : Ras activation uopn Ca2+ infux through NMDA receptor
Reactome : Trafficking of AMPA receptors
Reactome : Transmission across Chemical Synapses
Reactome : Unblocking of NMDA receptor, glutamate binding and activation
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Hypothetical Network for Drug Addiction
WikiPathway : Myometrial Relaxation and Contraction Pathways

Clone

Cloning Information : 164612
HIP Master Clone ID : 124248
Original Clone ID : FLH164612.01L

Organism


TAX_ID : 9606
Species Specific ID: 816

Genome

Chromosome : 7
Map Location : 7p14.3-p14.1
Ensembl : ENSG00000058404

Reagents

Labome : CAMK2B-antibody