DNASU Plasmid Repository • 480.965.5697 | Email

MAPK12 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAPK12
Gene Name:  mitogen-activated protein kinase 12
Sequence             
Original Clone ID: FLH164613.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00037939

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1104nts         Open reading frame : 1 to 1104
Reference Sequence Alignment

ATGAGCTCTCCGCCGCCCGCCCGCAGTGGCTTTTACCGCCAGGAGGTGACCAAGACGGCC
TGGGAGGTGCGCGCCGTGTACCGGGACCTGCAGCCCGTGGGCTCGGGCGCCTACGGCGCG
GTGTGCTCGGCCGTGGACGGCCGCACCGGCGCTAAGGTGGCCATCAAGAAGCTGTATCGG
CCCTTCCAGTCCGAGCTGTTCGCCAAGCGCGCCTACCGCGAGCTGCGCCTGCTCAAGCAC
ATGCGCCACGAGAACGTGATCGGGCTGCTGGACGTATTCACTCCTGATGAGACCCTGGAT
GACTTCACGGACTTTTACCTGGTGATGCCGTTCATGGGCACCGACCTGGGCAAGCTCATG
AAACATGAGAAGCTAGGCGAGGACCGGATCCAGTTCCTCGTGTACCAGATGCTGAAGGGG
CTGAGGTATATCCACGCTGCCGGCATCATCCACAGAGACCTGAAGCCCGGCAACCTGGCT
GTGAACGAAGACTGTGAGCTGAAGATCCTGGACTTCGGCCTGGCCAGGCAGGCAGACAGT
GAGATGACTGGGTACGTGGTGACCCGGTGGTACCGGGCTCCCGAGGTCATCTTGAATTGG
ATGCGCTACACGCAGACGGTGGACATCTGGTCCGTGGGCTGCATCATGGCGGAGATGATC
ACAGGCAAGACGCTGTTCAAGGGCAGCGACCACCTGGACCAGCTGAAGGAGATCATGAAG
GTGACGGGGACGCCTCCGGCTGAGTTTGTGCAGCGGCTGCAGAGCGATGAGGCCAAGAAC
TACATGAAGGGCCTCCCCGAATTGGAGAAGAAGGATTTTGCCTCTATCCTGACCAATGCA
AGCCCTCTGGCTGTGAACCTCCTGGAGAAGATGCTGGTGCTGGACGCGGAGCAGCGGGTG
ACGGCAGGCGAGGCGCTGGCCCATCCCTACTTCGAGTCCCTGCACGACACGGAAGATGAG
CCCCAGGTCCAGAAGTATGATGACTCCTTTGACGACGTTGACCGCACACTGGATGAATGG
AAGCGTGTTACTTACAAAGAGGTGCTCAGCTTCAAGCCTCCCCGGCAGCTGGGGGCCAGG
GTCTCCAAGGAGACACCTCTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1413
Start on reference sequence 310
Mutations:
None
Discrepancy:
a781t,N261Y; g1095a
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAPK12
Symbol Nomenclature : MAPK12
SYNONYM : ERK3; ERK6; P38GAMMA; PRKM12; SAPK-3; SAPK3
Designation : ERK-6|MAP kinase 12|MAP kinase p38 gamma|MAPK 12|extracellular signal-regulated kinase 6|mitogen-activated protein kinase 3|mitogen-activated protein kinase p38 gamma|stress-activated protein kinase 3
Full Nomenclature : mitogen-activated protein kinase 12
GENEID : 6300
HGNC : 6874
MIM : 602399
Vega : OTTHUMG00000030145
Target GenBank: NM_002969

 

Reference Sequence Alignment

  

HsCD00037939      ATGAGCTCTCCGCCGCCCGCCCGCAGTGGCTTTTACCGCCAGGAGGTGACCAAGACGGCC
NM_002969.3       ATGAGCTCTCCGCCGCCCGCCCGCAGTGGCTTTTACCGCCAGGAGGTGACCAAGACGGCC
                  ************************************************************

HsCD00037939      TGGGAGGTGCGCGCCGTGTACCGGGACCTGCAGCCCGTGGGCTCGGGCGCCTACGGCGCG
NM_002969.3       TGGGAGGTGCGCGCCGTGTACCGGGACCTGCAGCCCGTGGGCTCGGGCGCCTACGGCGCG
                  ************************************************************

HsCD00037939      GTGTGCTCGGCCGTGGACGGCCGCACCGGCGCTAAGGTGGCCATCAAGAAGCTGTATCGG
NM_002969.3       GTGTGCTCGGCCGTGGACGGCCGCACCGGCGCTAAGGTGGCCATCAAGAAGCTGTATCGG
                  ************************************************************

HsCD00037939      CCCTTCCAGTCCGAGCTGTTCGCCAAGCGCGCCTACCGCGAGCTGCGCCTGCTCAAGCAC
NM_002969.3       CCCTTCCAGTCCGAGCTGTTCGCCAAGCGCGCCTACCGCGAGCTGCGCCTGCTCAAGCAC
                  ************************************************************

HsCD00037939      ATGCGCCACGAGAACGTGATCGGGCTGCTGGACGTATTCACTCCTGATGAGACCCTGGAT
NM_002969.3       ATGCGCCACGAGAACGTGATCGGGCTGCTGGACGTATTCACTCCTGATGAGACCCTGGAT
                  ************************************************************

HsCD00037939      GACTTCACGGACTTTTACCTGGTGATGCCGTTCATGGGCACCGACCTGGGCAAGCTCATG
NM_002969.3       GACTTCACGGACTTTTACCTGGTGATGCCGTTCATGGGCACCGACCTGGGCAAGCTCATG
                  ************************************************************

HsCD00037939      AAACATGAGAAGCTAGGCGAGGACCGGATCCAGTTCCTCGTGTACCAGATGCTGAAGGGG
NM_002969.3       AAACATGAGAAGCTAGGCGAGGACCGGATCCAGTTCCTCGTGTACCAGATGCTGAAGGGG
                  ************************************************************

HsCD00037939      CTGAGGTATATCCACGCTGCCGGCATCATCCACAGAGACCTGAAGCCCGGCAACCTGGCT
NM_002969.3       CTGAGGTATATCCACGCTGCCGGCATCATCCACAGAGACCTGAAGCCCGGCAACCTGGCT
                  ************************************************************

HsCD00037939      GTGAACGAAGACTGTGAGCTGAAGATCCTGGACTTCGGCCTGGCCAGGCAGGCAGACAGT
NM_002969.3       GTGAACGAAGACTGTGAGCTGAAGATCCTGGACTTCGGCCTGGCCAGGCAGGCAGACAGT
                  ************************************************************

HsCD00037939      GAGATGACTGGGTACGTGGTGACCCGGTGGTACCGGGCTCCCGAGGTCATCTTGAATTGG
NM_002969.3       GAGATGACTGGGTACGTGGTGACCCGGTGGTACCGGGCTCCCGAGGTCATCTTGAATTGG
                  ************************************************************

HsCD00037939      ATGCGCTACACGCAGACGGTGGACATCTGGTCCGTGGGCTGCATCATGGCGGAGATGATC
NM_002969.3       ATGCGCTACACGCAGACGGTGGACATCTGGTCTGTGGGCTGCATCATGGCGGAGATGATC
                  ******************************** ***************************

HsCD00037939      ACAGGCAAGACGCTGTTCAAGGGCAGCGACCACCTGGACCAGCTGAAGGAGATCATGAAG
NM_002969.3       ACAGGCAAGACGCTGTTCAAGGGCAGCGACCACCTGGACCAGCTGAAGGAGATCATGAAG
                  ************************************************************

HsCD00037939      GTGACGGGGACGCCTCCGGCTGAGTTTGTGCAGCGGCTGCAGAGCGATGAGGCCAAGAAC
NM_002969.3       GTGACGGGGACGCCTCCGGCTGAGTTTGTGCAGCGGCTGCAGAGCGATGAGGCCAAGAAC
                  ************************************************************

HsCD00037939      TACATGAAGGGCCTCCCCGAATTGGAGAAGAAGGATTTTGCCTCTATCCTGACCAATGCA
NM_002969.3       TACATGAAGGGCCTCCCCGAATTGGAGAAGAAGGATTTTGCCTCTATCCTGACCAATGCA
                  ************************************************************

HsCD00037939      AGCCCTCTGGCTGTGAACCTCCTGGAGAAGATGCTGGTGCTGGACGCGGAGCAGCGGGTG
NM_002969.3       AGCCCTCTGGCTGTGAACCTCCTGGAGAAGATGCTGGTGCTGGACGCGGAGCAGCGGGTG
                  ************************************************************

HsCD00037939      ACGGCAGGCGAGGCGCTGGCCCATCCCTACTTCGAGTCCCTGCACGACACGGAAGATGAG
NM_002969.3       ACGGCAGGCGAGGCGCTGGCCCATCCCTACTTCGAGTCCCTGCACGACACGGAAGATGAG
                  ************************************************************

HsCD00037939      CCCCAGGTCCAGAAGTATGATGACTCCTTTGACGACGTTGACCGCACACTGGATGAATGG
NM_002969.3       CCCCAGGTCCAGAAGTATGATGACTCCTTTGACGACGTTGACCGCACACTGGATGAATGG
                  ************************************************************

HsCD00037939      AAGCGTGTTACTTACAAAGAGGTGCTCAGCTTCAAGCCTCCCCGGCAGCTGGGGGCCAGG
NM_002969.3       AAGCGTGTTACTTACAAAGAGGTGCTCAGCTTCAAGCCTCCCCGGCAGCTGGGGGCCAGG
                  ************************************************************

HsCD00037939      GTCTCCAAGGAGACACCTCTGTTG
NM_002969.3       GTCTCCAAGGAGACGCCTCTGTGA
                  **************.******* .

Pathways

NCI : RhoA signaling pathway
NCI : Signaling mediated by p38-gamma and p38-delta
Panther : Alzheimer disease-amyloid secretase pathway
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Interferon-gamma signaling pathway
Panther : Oxidative stress response
Panther : Parkinson disease
Panther : Ras Pathway
Panther : TGF-beta signaling pathway
Panther : p38 MAPK pathway
Panther : p53 pathway feedback loops 2
Reactome : Activation of PPARGC1A (PGC-1alpha) by phosphorylation
Reactome : CDO in myogenesis
Reactome : Cell-Cell communication
Reactome : DSCAM interactions
Reactome : Developmental Biology
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Mitochondrial biogenesis
Reactome : Myogenesis
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : NOD1/2 Signaling Pathway
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : Organelle biogenesis and maintenance
Reactome : Signal Transduction
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : p38MAPK events
WikiPathway : Focal Adhesion
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Lymphocyte TarBase
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : Muscle cell TarBase
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Signal Transduction of S1P Receptor
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 164613
HIP Master Clone ID : 124249
Original Clone ID : FLH164613.01L

Organism


TAX_ID : 9606
Species Specific ID: 6300

Genome

Chromosome : 22
Map Location : 22q13.33
Ensembl : ENSG00000188130

Reagents

Labome : MAPK12-antibody