DNASU Plasmid Repository • 480.965.5697 | Email

PTK2B (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PTK2B
Gene Name:  protein tyrosine kinase 2 beta
Sequence             
Original Clone ID: FLH164620.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00037946

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3030nts         Open reading frame : 1 to 3030
Reference Sequence Alignment

ATGTCTGGGGTGTCCGAGCCCCTGAGTCGAGTAAAGTTGGGCACGTTACGCCGGCCTGAA
GGCCCTGCAGAGCCCATGGTGGTGGTACCAGTAGATGTGGAAAAGGAGGACGTGCGTATC
CTCATGGTCTGCTTCTATAGCAACAGCTTCAATCCTGGGAAAAACTTCAAACTGGTCAAA
TGCACTGTCCAGACGGAGATCCGGGAGATCATCACCTCCATCCTGCTGAGCGGGCGGATC
GGGCCCAACATCCGGTTGGCTGAGTGCTATGGGCTGAGGCTGAAGCACATGAAGTCCGAT
GAGATCCACTGGCTGCACCCACAGATGACAGTGGGTGAGGTGCAGGACAAGTATGAGTGT
CTGCACGTGGAAGCCGAGTGGAGGTATGACCTTCAAATCCGCTACTTGCCAGAAGACTTC
ATGGAGAGCCTGAAGGAGGACAGGACCACGCTGCTCTATTTTTACCAACAGCTCCGGAAC
GACTACATGCAGCGCTACGCCAGCAAGGTCAGCGAGGGCATGGCCCTGCAGCTGGGCTGC
CTGGAGCTCAGGCGGTTCTTCAAGGATATGCCCCACAATGCACTTGACAAGAAGTCCAAC
TTCGAGCTCCTAGAAAAGGAAGTGGGGCTGGACTTGTTTTTCCCAAAGCAGATGCAGGAG
AACTTAAAGCCCAAACAGTTCCGGAAGATGATCCAGCAGACCTTCCAGCAGTACGCCTCG
CTCAGGGAGGAGGAGTGCGTCATGAAGTTCTTCAACACTCTCGCCGGCTTCGCCAACATC
GACCAGGAGACCTACCGCTGTGAACTCATTCAAGGATGGAACATTACTGTGGACCTGGTC
ATTGGCCCTAAAGGGATCCGCCAGCTGACTAGTCAGGACGCAAAGCCCACCTGCCTGGCC
GAGTTCAAGCAGATCAGGTCCATCAGGTGCCTCCCGCTGGAGGAGGGCCAGGCAGTACTT
CAGCTGGGCATTGAAGGTGCCCCCCAGGCCTTGTCCATCAAAACCTCATCCCTAGCAGAG
GCTGAGAACATGGCTGACCTCATAGACGGCTACTGCCGGCTGCAGGGTGAGCACCAAGGC
TCTCTCATCATCCATCCTAGGAAAGATGGTGAGAAGCGGAACAGCCTGCCCCAGATCCCC
ATGCTAAACCTGGAGGCCCGGCGGTCCCACCTCTCAGAGAGCTGCAGCATAGAGTCAGAC
ATCTACGCAGAGATTCCCGACGAAACCCTGCGAAGGCCCGGAGGTCCACAGTATGGCATT
GCCCGTGAAGATGTGGTCCTGAATCGTATTCTTGGGGAAGGCTTTTTTGGGGAGGTCTAT
GAAGGTGTCTACACAAATCATAAAGGGGAGAAAATCAATGTAGCTGTCAAGACCTGCAAG
AAAGACTGCACTCTGGACAACAAGGAGAAGTTCATGAGCGAGGCAGTGATCATGAAGAAC
CTCGACCACCCGCACATCGTGAAGCTGATCGGCATCATTGAAGAGGAGCCCACCTGGATC
ATCATGGAATTGTATCCCTATGGGGAGCTGGGCCACTACCTGGAGCGGAACAAGAACTCC
CTGAAGGTGCTCACCCTCGTGCTGTACTCACTGCAGATATGCAAAGCCATGGCCTACCTG
GAGAGCATCAACTGCGTGCACAGGGACATTGCTGTCCGGAACATCCTGGTGGCCTCCCCT
GAGTGTGTGAAGCTGGGGGACTTTGGTCTTTCCCGGTACATTGAGGACGAGGACTATTAC
AAAGCCTCTGTGACTCGTCTCCCCATCAAATGGATGTCCCCAGAGTCCATTAACTTCCGA
CGCTTCACGACAGCCAGTGACGTCTGGATGTTCGCCGTGTGCATGTGGGAGATCCTGAGC
TTTGGGAAGCAGCCCTTCTTCTGGCTGGAGAACAAGGATGTCATCGGGGTGCTGGAGAAA
GGAGACCGGCTGCCCAAGCCTGATCTCTGTCCACCGGTCCTTTATACCCTCATGACCCGC
TGCTGGGACTACGACCCCAGTGACCGGCCCCGCTTCACCGAGCTGGTGTGCAGCCTCAGT
GACGTTTATCAGATGGAGAAGGACATTGCCATGGAGCAAGAGAGGAATGCTCGCTACCGA
ACCCCCAAAATCTTGGAGCCCACAGCCTTCCAGGAACCCCCACCCAAGCCCAGCCGACCT
AAGTACAGACCCCCTCCGCAAACCAACCTCCTGGCTCCAAAGCTGCAGTTCCAGGTTCCT
GAGGGTCTGTGTGCCAGCTCTCCTACGCTCACCAGCCCTATGGAGTATCCATCTCCCGTT
AACTCACTGCACACCCCACCTCTCCACCGGCACAATGTCTTCAAACGCCACAGCATGCGG
GAGGAGGACTTCATCCAACCCAGCAGCCGAGAAGAGGCCCAGCAGCTGTGGGAGGCTGAA
AAGGTCAAAATGCGGCAAATCCTGGACAAACAGCAGAAGCAGATGGTGGAGGACTACCAG
TGGCTCAGGCAGGAGGAGAAGTCCCTGGACCCCATGGTTTATATGAATGATAAGTCCCCA
TTGACGCCAGAGAAGGAGGTCGGCTACCTGGAGTTCACAGGGCCCCCACAGAAGCCCCCG
AGGCTGGGCGCACAGTCCATCCAGCCCACAGCTAACCTGGACCGGACCGATGACCTGGTG
TACCTCAATGTCATGGAGCTGGTGCGGGCCGTGCTGGAGCTCAAGAATGAGCTCTGTCAG
CTGCCCCCCGAGGGCTACGTGGTGGTGGTGAAGAATGTGGGGCTGACCCTGCGGAAGCTC
ATCGGGAGCGTGGATGATCTCCTGCCTTCCTTGCCGTCATCTTCACGGACAGAGATCGAG
GGCACCCAGAAACTGCTCAACAAAGACCTGGCAGAGCTCATCAACAAGATGCGGCTGGCG
CAGCAGAACGCCGTGACCTCCCTGAGTGAGGAGTGCAAGAGGCAGATGCTGACGGCTTCA
CACACCCTGGCTATGGACGCCAAGAACCTGCTCGACGCTGTGGACCAGGCCAAGGTTCTG
GCCAATCTGGCCCACCCACCTGCAGAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 3137
Start on reference sequence 108
Mutations:
None
Discrepancy:
c27t; a45g;
 a125t,K42M; g162a;
 g330a; c1341t;
 g2953a,V985M
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PTK2B
Symbol Nomenclature : PTK2B
SYNONYM : CADTK; CAKB; FADK2; FAK2; PKB; PTK; PYK2; RAFTK
Designation : CAK-beta|FADK 2|PTK2B protein tyrosine kinase 2 beta|calcium-dependent tyrosine kinase|calcium-regulated non-receptor proline-rich tyrosine kinase|cell adhesion kinase beta|focal adhesion kinase 2|proline-rich tyrosine kinase 2|protein kinase B|protein-tyrosine kinase 2-beta|related adhesion focal tyrosine kinase
Full Nomenclature : protein tyrosine kinase 2 beta
GENEID : 2185
HGNC : 9612
MIM : 601212
Vega : OTTHUMG00000102082
Target GenBank: NM_004103

 

Reference Sequence Alignment

  

HsCD00037946      ATGTCTGGGGTGTCCGAGCCCCTGAGTCGAGTAAAGTTGGGCACGTTACGCCGGCCTGAA
NM_004103.4       ATGTCTGGGGTGTCCGAGCCCCTGAGTCGAGTAAAGTTGGGCACGTTACGCCGGCCTGAA
NM_173174.2       ATGTCTGGGGTGTCCGAGCCCCTGAGTCGAGTAAAGTTGGGCACGTTACGCCGGCCTGAA
NM_173176.2       ATGTCTGGGGTGTCCGAGCCCCTGAGTCGAGTAAAGTTGGGCACGTTACGCCGGCCTGAA
NM_173175.2       ATGTCTGGGGTGTCCGAGCCCCTGAGTCGAGTAAAGTTGGGCACGTTACGCCGGCCTGAA
                  ************************************************************

HsCD00037946      GGCCCTGCAGAGCCCATGGTGGTGGTACCAGTAGATGTGGAAAAGGAGGACGTGCGTATC
NM_004103.4       GGCCCTGCAGAGCCCATGGTGGTGGTACCAGTAGATGTGGAAAAGGAGGACGTGCGTATC
NM_173174.2       GGCCCTGCAGAGCCCATGGTGGTGGTACCAGTAGATGTGGAAAAGGAGGACGTGCGTATC
NM_173176.2       GGCCCTGCAGAGCCCATGGTGGTGGTACCAGTAGATGTGGAAAAGGAGGACGTGCGTATC
NM_173175.2       GGCCCTGCAGAGCCCATGGTGGTGGTACCAGTAGATGTGGAAAAGGAGGACGTGCGTATC
                  ************************************************************

HsCD00037946      CTCATGGTCTGCTTCTATAGCAACAGCTTCAATCCTGGGAAAAACTTCAAACTGGTCAAA
NM_004103.4       CTCAAGGTCTGCTTCTATAGCAACAGCTTCAATCCTGGGAAAAACTTCAAACTGGTCAAA
NM_173174.2       CTCAAGGTCTGCTTCTATAGCAACAGCTTCAATCCTGGGAAAAACTTCAAACTGGTCAAA
NM_173176.2       CTCAAGGTCTGCTTCTATAGCAACAGCTTCAATCCTGGGAAAAACTTCAAACTGGTCAAA
NM_173175.2       CTCAAGGTCTGCTTCTATAGCAACAGCTTCAATCCTGGGAAAAACTTCAAACTGGTCAAA
                  ****:*******************************************************

HsCD00037946      TGCACTGTCCAGACGGAGATCCGGGAGATCATCACCTCCATCCTGCTGAGCGGGCGGATC
NM_004103.4       TGCACTGTCCAGACGGAGATCCGGGAGATCATCACCTCCATCCTGCTGAGCGGGCGGATC
NM_173174.2       TGCACTGTCCAGACGGAGATCCGGGAGATCATCACCTCCATCCTGCTGAGCGGGCGGATC
NM_173176.2       TGCACTGTCCAGACGGAGATCCGGGAGATCATCACCTCCATCCTGCTGAGCGGGCGGATC
NM_173175.2       TGCACTGTCCAGACGGAGATCCGGGAGATCATCACCTCCATCCTGCTGAGCGGGCGGATC
                  ************************************************************

HsCD00037946      GGGCCCAACATCCGGTTGGCTGAGTGCTATGGGCTGAGGCTGAAGCACATGAAGTCCGAT
NM_004103.4       GGGCCCAACATCCGGTTGGCTGAGTGCTATGGGCTGAGGCTGAAGCACATGAAGTCCGAT
NM_173174.2       GGGCCCAACATCCGGTTGGCTGAGTGCTATGGGCTGAGGCTGAAGCACATGAAGTCCGAT
NM_173176.2       GGGCCCAACATCCGGTTGGCTGAGTGCTATGGGCTGAGGCTGAAGCACATGAAGTCCGAT
NM_173175.2       GGGCCCAACATCCGGTTGGCTGAGTGCTATGGGCTGAGGCTGAAGCACATGAAGTCCGAT
                  ************************************************************

HsCD00037946      GAGATCCACTGGCTGCACCCACAGATGACAGTGGGTGAGGTGCAGGACAAGTATGAGTGT
NM_004103.4       GAGATCCACTGGCTGCACCCACAGATGACGGTGGGTGAGGTGCAGGACAAGTATGAGTGT
NM_173174.2       GAGATCCACTGGCTGCACCCACAGATGACGGTGGGTGAGGTGCAGGACAAGTATGAGTGT
NM_173176.2       GAGATCCACTGGCTGCACCCACAGATGACGGTGGGTGAGGTGCAGGACAAGTATGAGTGT
NM_173175.2       GAGATCCACTGGCTGCACCCACAGATGACGGTGGGTGAGGTGCAGGACAAGTATGAGTGT
                  *****************************.******************************

HsCD00037946      CTGCACGTGGAAGCCGAGTGGAGGTATGACCTTCAAATCCGCTACTTGCCAGAAGACTTC
NM_004103.4       CTGCACGTGGAAGCCGAGTGGAGGTATGACCTTCAAATCCGCTACTTGCCAGAAGACTTC
NM_173174.2       CTGCACGTGGAAGCCGAGTGGAGGTATGACCTTCAAATCCGCTACTTGCCAGAAGACTTC
NM_173176.2       CTGCACGTGGAAGCCGAGTGGAGGTATGACCTTCAAATCCGCTACTTGCCAGAAGACTTC
NM_173175.2       CTGCACGTGGAAGCCGAGTGGAGGTATGACCTTCAAATCCGCTACTTGCCAGAAGACTTC
                  ************************************************************

HsCD00037946      ATGGAGAGCCTGAAGGAGGACAGGACCACGCTGCTCTATTTTTACCAACAGCTCCGGAAC
NM_004103.4       ATGGAGAGCCTGAAGGAGGACAGGACCACGCTGCTCTATTTTTACCAACAGCTCCGGAAC
NM_173174.2       ATGGAGAGCCTGAAGGAGGACAGGACCACGCTGCTCTATTTTTACCAACAGCTCCGGAAC
NM_173176.2       ATGGAGAGCCTGAAGGAGGACAGGACCACGCTGCTCTATTTTTACCAACAGCTCCGGAAC
NM_173175.2       ATGGAGAGCCTGAAGGAGGACAGGACCACGCTGCTCTATTTTTACCAACAGCTCCGGAAC
                  ************************************************************

HsCD00037946      GACTACATGCAGCGCTACGCCAGCAAGGTCAGCGAGGGCATGGCCCTGCAGCTGGGCTGC
NM_004103.4       GACTACATGCAGCGCTACGCCAGCAAGGTCAGCGAGGGCATGGCCCTGCAGCTGGGCTGC
NM_173174.2       GACTACATGCAGCGCTACGCCAGCAAGGTCAGCGAGGGCATGGCCCTGCAGCTGGGCTGC
NM_173176.2       GACTACATGCAGCGCTACGCCAGCAAGGTCAGCGAGGGCATGGCCCTGCAGCTGGGCTGC
NM_173175.2       GACTACATGCAGCGCTACGCCAGCAAGGTCAGCGAGGGCATGGCCCTGCAGCTGGGCTGC
                  ************************************************************

HsCD00037946      CTGGAGCTCAGGCGGTTCTTCAAGGATATGCCCCACAATGCACTTGACAAGAAGTCCAAC
NM_004103.4       CTGGAGCTCAGGCGGTTCTTCAAGGATATGCCCCACAATGCACTTGACAAGAAGTCCAAC
NM_173174.2       CTGGAGCTCAGGCGGTTCTTCAAGGATATGCCCCACAATGCACTTGACAAGAAGTCCAAC
NM_173176.2       CTGGAGCTCAGGCGGTTCTTCAAGGATATGCCCCACAATGCACTTGACAAGAAGTCCAAC
NM_173175.2       CTGGAGCTCAGGCGGTTCTTCAAGGATATGCCCCACAATGCACTTGACAAGAAGTCCAAC
                  ************************************************************

HsCD00037946      TTCGAGCTCCTAGAAAAGGAAGTGGGGCTGGACTTGTTTTTCCCAAAGCAGATGCAGGAG
NM_004103.4       TTCGAGCTCCTAGAAAAGGAAGTGGGGCTGGACTTGTTTTTCCCAAAGCAGATGCAGGAG
NM_173174.2       TTCGAGCTCCTAGAAAAGGAAGTGGGGCTGGACTTGTTTTTCCCAAAGCAGATGCAGGAG
NM_173176.2       TTCGAGCTCCTAGAAAAGGAAGTGGGGCTGGACTTGTTTTTCCCAAAGCAGATGCAGGAG
NM_173175.2       TTCGAGCTCCTAGAAAAGGAAGTGGGGCTGGACTTGTTTTTCCCAAAGCAGATGCAGGAG
                  ************************************************************

HsCD00037946      AACTTAAAGCCCAAACAGTTCCGGAAGATGATCCAGCAGACCTTCCAGCAGTACGCCTCG
NM_004103.4       AACTTAAAGCCCAAACAGTTCCGGAAGATGATCCAGCAGACCTTCCAGCAGTACGCCTCG
NM_173174.2       AACTTAAAGCCCAAACAGTTCCGGAAGATGATCCAGCAGACCTTCCAGCAGTACGCCTCG
NM_173176.2       AACTTAAAGCCCAAACAGTTCCGGAAGATGATCCAGCAGACCTTCCAGCAGTACGCCTCG
NM_173175.2       AACTTAAAGCCCAAACAGTTCCGGAAGATGATCCAGCAGACCTTCCAGCAGTACGCCTCG
                  ************************************************************

HsCD00037946      CTCAGGGAGGAGGAGTGCGTCATGAAGTTCTTCAACACTCTCGCCGGCTTCGCCAACATC
NM_004103.4       CTCAGGGAGGAGGAGTGCGTCATGAAGTTCTTCAACACTCTCGCCGGCTTCGCCAACATC
NM_173174.2       CTCAGGGAGGAGGAGTGCGTCATGAAGTTCTTCAACACTCTCGCCGGCTTCGCCAACATC
NM_173176.2       CTCAGGGAGGAGGAGTGCGTCATGAAGTTCTTCAACACTCTCGCCGGCTTCGCCAACATC
NM_173175.2       CTCAGGGAGGAGGAGTGCGTCATGAAGTTCTTCAACACTCTCGCCGGCTTCGCCAACATC
                  ************************************************************

HsCD00037946      GACCAGGAGACCTACCGCTGTGAACTCATTCAAGGATGGAACATTACTGTGGACCTGGTC
NM_004103.4       GACCAGGAGACCTACCGCTGTGAACTCATTCAAGGATGGAACATTACTGTGGACCTGGTC
NM_173174.2       GACCAGGAGACCTACCGCTGTGAACTCATTCAAGGATGGAACATTACTGTGGACCTGGTC
NM_173176.2       GACCAGGAGACCTACCGCTGTGAACTCATTCAAGGATGGAACATTACTGTGGACCTGGTC
NM_173175.2       GACCAGGAGACCTACCGCTGTGAACTCATTCAAGGATGGAACATTACTGTGGACCTGGTC
                  ************************************************************

HsCD00037946      ATTGGCCCTAAAGGGATCCGCCAGCTGACTAGTCAGGACGCAAAGCCCACCTGCCTGGCC
NM_004103.4       ATTGGCCCTAAAGGGATCCGCCAGCTGACTAGTCAGGACGCAAAGCCCACCTGCCTGGCC
NM_173174.2       ATTGGCCCTAAAGGGATCCGCCAGCTGACTAGTCAGGACGCAAAGCCCACCTGCCTGGCC
NM_173176.2       ATTGGCCCTAAAGGGATCCGCCAGCTGACTAGTCAGGACGCAAAGCCCACCTGCCTGGCC
NM_173175.2       ATTGGCCCTAAAGGGATCCGCCAGCTGACTAGTCAGGACGCAAAGCCCACCTGCCTGGCC
                  ************************************************************

HsCD00037946      GAGTTCAAGCAGATCAGGTCCATCAGGTGCCTCCCGCTGGAGGAGGGCCAGGCAGTACTT
NM_004103.4       GAGTTCAAGCAGATCAGGTCCATCAGGTGCCTCCCGCTGGAGGAGGGCCAGGCAGTACTT
NM_173174.2       GAGTTCAAGCAGATCAGGTCCATCAGGTGCCTCCCGCTGGAGGAGGGCCAGGCAGTACTT
NM_173176.2       GAGTTCAAGCAGATCAGGTCCATCAGGTGCCTCCCGCTGGAGGAGGGCCAGGCAGTACTT
NM_173175.2       GAGTTCAAGCAGATCAGGTCCATCAGGTGCCTCCCGCTGGAGGAGGGCCAGGCAGTACTT
                  ************************************************************

HsCD00037946      CAGCTGGGCATTGAAGGTGCCCCCCAGGCCTTGTCCATCAAAACCTCATCCCTAGCAGAG
NM_004103.4       CAGCTGGGCATTGAAGGTGCCCCCCAGGCCTTGTCCATCAAAACCTCATCCCTAGCAGAG
NM_173174.2       CAGCTGGGCATTGAAGGTGCCCCCCAGGCCTTGTCCATCAAAACCTCATCCCTAGCAGAG
NM_173176.2       CAGCTGGGCATTGAAGGTGCCCCCCAGGCCTTGTCCATCAAAACCTCATCCCTAGCAGAG
NM_173175.2       CAGCTGGGCATTGAAGGTGCCCCCCAGGCCTTGTCCATCAAAACCTCATCCCTAGCAGAG
                  ************************************************************

HsCD00037946      GCTGAGAACATGGCTGACCTCATAGACGGCTACTGCCGGCTGCAGGGTGAGCACCAAGGC
NM_004103.4       GCTGAGAACATGGCTGACCTCATAGACGGCTACTGCCGGCTGCAGGGTGAGCACCAAGGC
NM_173174.2       GCTGAGAACATGGCTGACCTCATAGACGGCTACTGCCGGCTGCAGGGTGAGCACCAAGGC
NM_173176.2       GCTGAGAACATGGCTGACCTCATAGACGGCTACTGCCGGCTGCAGGGTGAGCACCAAGGC
NM_173175.2       GCTGAGAACATGGCTGACCTCATAGACGGCTACTGCCGGCTGCAGGGTGAGCACCAAGGC
                  ************************************************************

HsCD00037946      TCTCTCATCATCCATCCTAGGAAAGATGGTGAGAAGCGGAACAGCCTGCCCCAGATCCCC
NM_004103.4       TCTCTCATCATCCATCCTAGGAAAGATGGTGAGAAGCGGAACAGCCTGCCCCAGATCCCC
NM_173174.2       TCTCTCATCATCCATCCTAGGAAAGATGGTGAGAAGCGGAACAGCCTGCCCCAGATCCCC
NM_173176.2       TCTCTCATCATCCATCCTAGGAAAGATGGTGAGAAGCGGAACAGCCTGCCCCAGATCCCC
NM_173175.2       TCTCTCATCATCCATCCTAGGAAAGATGGTGAGAAGCGGAACAGCCTGCCCCAGATCCCC
                  ************************************************************

HsCD00037946      ATGCTAAACCTGGAGGCCCGGCGGTCCCACCTCTCAGAGAGCTGCAGCATAGAGTCAGAC
NM_004103.4       ATGCTAAACCTGGAGGCCCGGCGGTCCCACCTCTCAGAGAGCTGCAGCATAGAGTCAGAC
NM_173174.2       ATGCTAAACCTGGAGGCCCGGCGGTCCCACCTCTCAGAGAGCTGCAGCATAGAGTCAGAC
NM_173176.2       ATGCTAAACCTGGAGGCCCGGCGGTCCCACCTCTCAGAGAGCTGCAGCATAGAGTCAGAC
NM_173175.2       ATGCTAAACCTGGAGGCCCGGCGGTCCCACCTCTCAGAGAGCTGCAGCATAGAGTCAGAC
                  ************************************************************

HsCD00037946      ATCTACGCAGAGATTCCCGACGAAACCCTGCGAAGGCCCGGAGGTCCACAGTATGGCATT
NM_004103.4       ATCTACGCAGAGATTCCCGACGAAACCCTGCGAAGGCCCGGAGGTCCACAGTATGGCATT
NM_173174.2       ATCTACGCAGAGATTCCCGACGAAACCCTGCGAAGGCCCGGAGGTCCACAGTATGGCATT
NM_173176.2       ATCTACGCAGAGATTCCCGACGAAACCCTGCGAAGGCCCGGAGGTCCACAGTATGGCATT
NM_173175.2       ATCTACGCAGAGATTCCCGACGAAACCCTGCGAAGGCCCGGAGGTCCACAGTATGGCATT
                  ************************************************************

HsCD00037946      GCCCGTGAAGATGTGGTCCTGAATCGTATTCTTGGGGAAGGCTTTTTTGGGGAGGTCTAT
NM_004103.4       GCCCGTGAAGATGTGGTCCTGAATCGTATTCTTGGGGAAGGCTTTTTTGGGGAGGTCTAT
NM_173174.2       GCCCGTGAAGATGTGGTCCTGAATCGTATTCTTGGGGAAGGCTTTTTTGGGGAGGTCTAT
NM_173176.2       GCCCGTGAAGATGTGGTCCTGAATCGTATTCTTGGGGAAGGCTTTTTTGGGGAGGTCTAT
NM_173175.2       GCCCGTGAAGATGTGGTCCTGAATCGTATTCTTGGGGAAGGCTTTTTTGGGGAGGTCTAT
                  ************************************************************

HsCD00037946      GAAGGTGTCTACACAAATCATAAAGGGGAGAAAATCAATGTAGCTGTCAAGACCTGCAAG
NM_004103.4       GAAGGTGTCTACACAAATCACAAAGGGGAGAAAATCAATGTAGCTGTCAAGACCTGCAAG
NM_173174.2       GAAGGTGTCTACACAAATCACAAAGGGGAGAAAATCAATGTAGCTGTCAAGACCTGCAAG
NM_173176.2       GAAGGTGTCTACACAAATCACAAAGGGGAGAAAATCAATGTAGCTGTCAAGACCTGCAAG
NM_173175.2       GAAGGTGTCTACACAAATCACAAAGGGGAGAAAATCAATGTAGCTGTCAAGACCTGCAAG
                  ******************** ***************************************

HsCD00037946      AAAGACTGCACTCTGGACAACAAGGAGAAGTTCATGAGCGAGGCAGTGATCATGAAGAAC
NM_004103.4       AAAGACTGCACTCTGGACAACAAGGAGAAGTTCATGAGCGAGGCAGTGATCATGAAGAAC
NM_173174.2       AAAGACTGCACTCTGGACAACAAGGAGAAGTTCATGAGCGAGGCAGTGATCATGAAGAAC
NM_173176.2       AAAGACTGCACTCTGGACAACAAGGAGAAGTTCATGAGCGAGGCAGTGATCATGAAGAAC
NM_173175.2       AAAGACTGCACTCTGGACAACAAGGAGAAGTTCATGAGCGAGGCAGTGATCATGAAGAAC
                  ************************************************************

HsCD00037946      CTCGACCACCCGCACATCGTGAAGCTGATCGGCATCATTGAAGAGGAGCCCACCTGGATC
NM_004103.4       CTCGACCACCCGCACATCGTGAAGCTGATCGGCATCATTGAAGAGGAGCCCACCTGGATC
NM_173174.2       CTCGACCACCCGCACATCGTGAAGCTGATCGGCATCATTGAAGAGGAGCCCACCTGGATC
NM_173176.2       CTCGACCACCCGCACATCGTGAAGCTGATCGGCATCATTGAAGAGGAGCCCACCTGGATC
NM_173175.2       CTCGACCACCCGCACATCGTGAAGCTGATCGGCATCATTGAAGAGGAGCCCACCTGGATC
                  ************************************************************

HsCD00037946      ATCATGGAATTGTATCCCTATGGGGAGCTGGGCCACTACCTGGAGCGGAACAAGAACTCC
NM_004103.4       ATCATGGAATTGTATCCCTATGGGGAGCTGGGCCACTACCTGGAGCGGAACAAGAACTCC
NM_173174.2       ATCATGGAATTGTATCCCTATGGGGAGCTGGGCCACTACCTGGAGCGGAACAAGAACTCC
NM_173176.2       ATCATGGAATTGTATCCCTATGGGGAGCTGGGCCACTACCTGGAGCGGAACAAGAACTCC
NM_173175.2       ATCATGGAATTGTATCCCTATGGGGAGCTGGGCCACTACCTGGAGCGGAACAAGAACTCC
                  ************************************************************

HsCD00037946      CTGAAGGTGCTCACCCTCGTGCTGTACTCACTGCAGATATGCAAAGCCATGGCCTACCTG
NM_004103.4       CTGAAGGTGCTCACCCTCGTGCTGTACTCACTGCAGATATGCAAAGCCATGGCCTACCTG
NM_173174.2       CTGAAGGTGCTCACCCTCGTGCTGTACTCACTGCAGATATGCAAAGCCATGGCCTACCTG
NM_173176.2       CTGAAGGTGCTCACCCTCGTGCTGTACTCACTGCAGATATGCAAAGCCATGGCCTACCTG
NM_173175.2       CTGAAGGTGCTCACCCTCGTGCTGTACTCACTGCAGATATGCAAAGCCATGGCCTACCTG
                  ************************************************************

HsCD00037946      GAGAGCATCAACTGCGTGCACAGGGACATTGCTGTCCGGAACATCCTGGTGGCCTCCCCT
NM_004103.4       GAGAGCATCAACTGCGTGCACAGGGACATTGCTGTCCGGAACATCCTGGTGGCCTCCCCT
NM_173174.2       GAGAGCATCAACTGCGTGCACAGGGACATTGCTGTCCGGAACATCCTGGTGGCCTCCCCT
NM_173176.2       GAGAGCATCAACTGCGTGCACAGGGACATTGCTGTCCGGAACATCCTGGTGGCCTCCCCT
NM_173175.2       GAGAGCATCAACTGCGTGCACAGGGACATTGCTGTCCGGAACATCCTGGTGGCCTCCCCT
                  ************************************************************

HsCD00037946      GAGTGTGTGAAGCTGGGGGACTTTGGTCTTTCCCGGTACATTGAGGACGAGGACTATTAC
NM_004103.4       GAGTGTGTGAAGCTGGGGGACTTTGGTCTTTCCCGGTACATTGAGGACGAGGACTATTAC
NM_173174.2       GAGTGTGTGAAGCTGGGGGACTTTGGTCTTTCCCGGTACATTGAGGACGAGGACTATTAC
NM_173176.2       GAGTGTGTGAAGCTGGGGGACTTTGGTCTTTCCCGGTACATTGAGGACGAGGACTATTAC
NM_173175.2       GAGTGTGTGAAGCTGGGGGACTTTGGTCTTTCCCGGTACATTGAGGACGAGGACTATTAC
                  ************************************************************

HsCD00037946      AAAGCCTCTGTGACTCGTCTCCCCATCAAATGGATGTCCCCAGAGTCCATTAACTTCCGA
NM_004103.4       AAAGCCTCTGTGACTCGTCTCCCCATCAAATGGATGTCCCCAGAGTCCATTAACTTCCGA
NM_173174.2       AAAGCCTCTGTGACTCGTCTCCCCATCAAATGGATGTCCCCAGAGTCCATTAACTTCCGA
NM_173176.2       AAAGCCTCTGTGACTCGTCTCCCCATCAAATGGATGTCCCCAGAGTCCATTAACTTCCGA
NM_173175.2       AAAGCCTCTGTGACTCGTCTCCCCATCAAATGGATGTCCCCAGAGTCCATTAACTTCCGA
                  ************************************************************

HsCD00037946      CGCTTCACGACAGCCAGTGACGTCTGGATGTTCGCCGTGTGCATGTGGGAGATCCTGAGC
NM_004103.4       CGCTTCACGACAGCCAGTGACGTCTGGATGTTCGCCGTGTGCATGTGGGAGATCCTGAGC
NM_173174.2       CGCTTCACGACAGCCAGTGACGTCTGGATGTTCGCCGTGTGCATGTGGGAGATCCTGAGC
NM_173176.2       CGCTTCACGACAGCCAGTGACGTCTGGATGTTCGCCGTGTGCATGTGGGAGATCCTGAGC
NM_173175.2       CGCTTCACGACAGCCAGTGACGTCTGGATGTTCGCCGTGTGCATGTGGGAGATCCTGAGC
                  ************************************************************

HsCD00037946      TTTGGGAAGCAGCCCTTCTTCTGGCTGGAGAACAAGGATGTCATCGGGGTGCTGGAGAAA
NM_004103.4       TTTGGGAAGCAGCCCTTCTTCTGGCTGGAGAACAAGGATGTCATCGGGGTGCTGGAGAAA
NM_173174.2       TTTGGGAAGCAGCCCTTCTTCTGGCTGGAGAACAAGGATGTCATCGGGGTGCTGGAGAAA
NM_173176.2       TTTGGGAAGCAGCCCTTCTTCTGGCTGGAGAACAAGGATGTCATCGGGGTGCTGGAGAAA
NM_173175.2       TTTGGGAAGCAGCCCTTCTTCTGGCTGGAGAACAAGGATGTCATCGGGGTGCTGGAGAAA
                  ************************************************************

HsCD00037946      GGAGACCGGCTGCCCAAGCCTGATCTCTGTCCACCGGTCCTTTATACCCTCATGACCCGC
NM_004103.4       GGAGACCGGCTGCCCAAGCCTGATCTCTGTCCACCGGTCCTTTATACCCTCATGACCCGC
NM_173174.2       GGAGACCGGCTGCCCAAGCCTGATCTCTGTCCACCGGTCCTTTATACCCTCATGACCCGC
NM_173176.2       GGAGACCGGCTGCCCAAGCCTGATCTCTGTCCACCGGTCCTTTATACCCTCATGACCCGC
NM_173175.2       GGAGACCGGCTGCCCAAGCCTGATCTCTGTCCACCGGTCCTTTATACCCTCATGACCCGC
                  ************************************************************

HsCD00037946      TGCTGGGACTACGACCCCAGTGACCGGCCCCGCTTCACCGAGCTGGTGTGCAGCCTCAGT
NM_004103.4       TGCTGGGACTACGACCCCAGTGACCGGCCCCGCTTCACCGAGCTGGTGTGCAGCCTCAGT
NM_173174.2       TGCTGGGACTACGACCCCAGTGACCGGCCCCGCTTCACCGAGCTGGTGTGCAGCCTCAGT
NM_173176.2       TGCTGGGACTACGACCCCAGTGACCGGCCCCGCTTCACCGAGCTGGTGTGCAGCCTCAGT
NM_173175.2       TGCTGGGACTACGACCCCAGTGACCGGCCCCGCTTCACCGAGCTGGTGTGCAGCCTCAGT
                  ************************************************************

HsCD00037946      GACGTTTATCAGATGGAGAAGGACATTGCCATGGAGCAAGAGAGGAATGCTCGCTACCGA
NM_004103.4       GACGTTTATCAGATGGAGAAGGACATTGCCATGGAGCAAGAGAGGAATGCTCGCTACCGA
NM_173174.2       GACGTTTATCAGATGGAGAAGGACATTGCCATGGAGCAAGAGAGGAATGCTCGCTACCGA
NM_173176.2       GACGTTTATCAGATGGAGAAGGACATTGCCATGGAGCAAGAGAGGAATGCTCGCTACCGA
NM_173175.2       GACGTTTATCAGATGGAGAAGGACATTGCCATGGAGCAAGAGAGGAATGCTCGCTACCGA
                  ************************************************************

HsCD00037946      ACCCCCAAAATCTTGGAGCCCACAGCCTTCCAGGAACCCCCACCCAAGCCCAGCCGACCT
NM_004103.4       ACCCCCAAAATCTTGGAGCCCACAGCCTTCCAGGAACCCCCACCCAAGCCCAGCCGACCT
NM_173174.2       ACCCCCAAAATCTTGGAGCCCACAGCCTTCCAGGAACCCCCACCCAAGCCCAGCCGACCT
NM_173176.2       ACCCCCAAAATCTTGGAGCCCACAGCCTTCCAGGAACCCCCACCCAAGCCCAGCCGACCT
NM_173175.2       ACCCCCAAAATCTTGGAGCCCACAGCCTTCCAGGAACCCCCACCCAAGCCCAGCCGACCT
                  ************************************************************

HsCD00037946      AAGTACAGACCCCCTCCGCAAACCAACCTCCTGGCTCCAAAGCTGCAGTTCCAGGTTCCT
NM_004103.4       AAGTACAGACCCCCTCCGCAAACCAACCTCCTGGCTCCAAAGCTGCAGTTCCAGGTTCCT
NM_173174.2       AAGTACAGACCCCCTCCGCAAACCAACCTCCTGGCTCCAAAGCTGCAGTTCCAGGTTCCT
NM_173176.2       AAGTACAGACCCCCTCCGCAAACCAACCTCCTGGCTCCAAAGCTGCAGTTCCAGGTTCCT
NM_173175.2       AAGTACAGACCCCCTCCGCAAACCAACCTCCTGGCTCCAAAGCTGCAGTTCCAG------
                  ******************************************************      

HsCD00037946      GAGGGTCTGTGTGCCAGCTCTCCTACGCTCACCAGCCCTATGGAGTATCCATCTCCCGTT
NM_004103.4       GAGGGTCTGTGTGCCAGCTCTCCTACGCTCACCAGCCCTATGGAGTATCCATCTCCCGTT
NM_173174.2       GAGGGTCTGTGTGCCAGCTCTCCTACGCTCACCAGCCCTATGGAGTATCCATCTCCCGTT
NM_173176.2       GAGGGTCTGTGTGCCAGCTCTCCTACGCTCACCAGCCCTATGGAGTATCCATCTCCCGTT
NM_173175.2       ------------------------------------------------------------
                                                                              

HsCD00037946      AACTCACTGCACACCCCACCTCTCCACCGGCACAATGTCTTCAAACGCCACAGCATGCGG
NM_004103.4       AACTCACTGCACACCCCACCTCTCCACCGGCACAATGTCTTCAAACGCCACAGCATGCGG
NM_173174.2       AACTCACTGCACACCCCACCTCTCCACCGGCACAATGTCTTCAAACGCCACAGCATGCGG
NM_173176.2       AACTCACTGCACACCCCACCTCTCCACCGGCACAATGTCTTCAAACGCCACAGCATGCGG
NM_173175.2       ------------------------------------------------------------
                                                                              

HsCD00037946      GAGGAGGACTTCATCCAACCCAGCAGCCGAGAAGAGGCCCAGCAGCTGTGGGAGGCTGAA
NM_004103.4       GAGGAGGACTTCATCCAACCCAGCAGCCGAGAAGAGGCCCAGCAGCTGTGGGAGGCTGAA
NM_173174.2       GAGGAGGACTTCATCCAACCCAGCAGCCGAGAAGAGGCCCAGCAGCTGTGGGAGGCTGAA
NM_173176.2       GAGGAGGACTTCATCCAACCCAGCAGCCGAGAAGAGGCCCAGCAGCTGTGGGAGGCTGAA
NM_173175.2       GAGGAGGACTTCATCCAACCCAGCAGCCGAGAAGAGGCCCAGCAGCTGTGGGAGGCTGAA
                  ************************************************************

HsCD00037946      AAGGTCAAAATGCGGCAAATCCTGGACAAACAGCAGAAGCAGATGGTGGAGGACTACCAG
NM_004103.4       AAGGTCAAAATGCGGCAAATCCTGGACAAACAGCAGAAGCAGATGGTGGAGGACTACCAG
NM_173174.2       AAGGTCAAAATGCGGCAAATCCTGGACAAACAGCAGAAGCAGATGGTGGAGGACTACCAG
NM_173176.2       AAGGTCAAAATGCGGCAAATCCTGGACAAACAGCAGAAGCAGATGGTGGAGGACTACCAG
NM_173175.2       AAGGTCAAAATGCGGCAAATCCTGGACAAACAGCAGAAGCAGATGGTGGAGGACTACCAG
                  ************************************************************

HsCD00037946      TGGCTCAGGCAGGAGGAGAAGTCCCTGGACCCCATGGTTTATATGAATGATAAGTCCCCA
NM_004103.4       TGGCTCAGGCAGGAGGAGAAGTCCCTGGACCCCATGGTTTATATGAATGATAAGTCCCCA
NM_173174.2       TGGCTCAGGCAGGAGGAGAAGTCCCTGGACCCCATGGTTTATATGAATGATAAGTCCCCA
NM_173176.2       TGGCTCAGGCAGGAGGAGAAGTCCCTGGACCCCATGGTTTATATGAATGATAAGTCCCCA
NM_173175.2       TGGCTCAGGCAGGAGGAGAAGTCCCTGGACCCCATGGTTTATATGAATGATAAGTCCCCA
                  ************************************************************

HsCD00037946      TTGACGCCAGAGAAGGAGGTCGGCTACCTGGAGTTCACAGGGCCCCCACAGAAGCCCCCG
NM_004103.4       TTGACGCCAGAGAAGGAGGTCGGCTACCTGGAGTTCACAGGGCCCCCACAGAAGCCCCCG
NM_173174.2       TTGACGCCAGAGAAGGAGGTCGGCTACCTGGAGTTCACAGGGCCCCCACAGAAGCCCCCG
NM_173176.2       TTGACGCCAGAGAAGGAGGTCGGCTACCTGGAGTTCACAGGGCCCCCACAGAAGCCCCCG
NM_173175.2       TTGACGCCAGAGAAGGAGGTCGGCTACCTGGAGTTCACAGGGCCCCCACAGAAGCCCCCG
                  ************************************************************

HsCD00037946      AGGCTGGGCGCACAGTCCATCCAGCCCACAGCTAACCTGGACCGGACCGATGACCTGGTG
NM_004103.4       AGGCTGGGCGCACAGTCCATCCAGCCCACAGCTAACCTGGACCGGACTGATGACCTGGTG
NM_173174.2       AGGCTGGGCGCACAGTCCATCCAGCCCACAGCTAACCTGGACCGGACTGATGACCTGGTG
NM_173176.2       AGGCTGGGCGCACAGTCCATCCAGCCCACAGCTAACCTGGACCGGACTGATGACCTGGTG
NM_173175.2       AGGCTGGGCGCACAGTCCATCCAGCCCACAGCTAACCTGGACCGGACTGATGACCTGGTG
                  *********************************************** ************

HsCD00037946      TACCTCAATGTCATGGAGCTGGTGCGGGCCGTGCTGGAGCTCAAGAATGAGCTCTGTCAG
NM_004103.4       TACCTCAATGTCATGGAGCTGGTGCGGGCCGTGCTGGAGCTCAAGAATGAGCTCTGTCAG
NM_173174.2       TACCTCAATGTCATGGAGCTGGTGCGGGCCGTGCTGGAGCTCAAGAATGAGCTCTGTCAG
NM_173176.2       TACCTCAATGTCATGGAGCTGGTGCGGGCCGTGCTGGAGCTCAAGAATGAGCTCTGTCAG
NM_173175.2       TACCTCAATGTCATGGAGCTGGTGCGGGCCGTGCTGGAGCTCAAGAATGAGCTCTGTCAG
                  ************************************************************

HsCD00037946      CTGCCCCCCGAGGGCTACGTGGTGGTGGTGAAGAATGTGGGGCTGACCCTGCGGAAGCTC
NM_004103.4       CTGCCCCCCGAGGGCTACGTGGTGGTGGTGAAGAATGTGGGGCTGACCCTGCGGAAGCTC
NM_173174.2       CTGCCCCCCGAGGGCTACGTGGTGGTGGTGAAGAATGTGGGGCTGACCCTGCGGAAGCTC
NM_173176.2       CTGCCCCCCGAGGGCTACGTGGTGGTGGTGAAGAATGTGGGGCTGACCCTGCGGAAGCTC
NM_173175.2       CTGCCCCCCGAGGGCTACGTGGTGGTGGTGAAGAATGTGGGGCTGACCCTGCGGAAGCTC
                  ************************************************************

HsCD00037946      ATCGGGAGCGTGGATGATCTCCTGCCTTCCTTGCCGTCATCTTCACGGACAGAGATCGAG
NM_004103.4       ATCGGGAGCGTGGATGATCTCCTGCCTTCCTTGCCGTCATCTTCACGGACAGAGATCGAG
NM_173174.2       ATCGGGAGCGTGGATGATCTCCTGCCTTCCTTGCCGTCATCTTCACGGACAGAGATCGAG
NM_173176.2       ATCGGGAGCGTGGATGATCTCCTGCCTTCCTTGCCGTCATCTTCACGGACAGAGATCGAG
NM_173175.2       ATCGGGAGCGTGGATGATCTCCTGCCTTCCTTGCCGTCATCTTCACGGACAGAGATCGAG
                  ************************************************************

HsCD00037946      GGCACCCAGAAACTGCTCAACAAAGACCTGGCAGAGCTCATCAACAAGATGCGGCTGGCG
NM_004103.4       GGCACCCAGAAACTGCTCAACAAAGACCTGGCAGAGCTCATCAACAAGATGCGGCTGGCA
NM_173174.2       GGCACCCAGAAACTGCTCAACAAAGACCTGGCAGAGCTCATCAACAAGATGCGGCTGGCA
NM_173176.2       GGCACCCAGAAACTGCTCAACAAAGACCTGGCAGAGCTCATCAACAAGATGCGGCTGGCA
NM_173175.2       GGCACCCAGAAACTGCTCAACAAAGACCTGGCAGAGCTCATCAACAAGATGCGGCTGGCA
                  ***********************************************************.

HsCD00037946      CAGCAGAACGCCGTGACCTCCCTGAGTGAGGAGTGCAAGAGGCAGATGCTGACGGCTTCA
NM_004103.4       CAGCAGAACGCCGTGACCTCCCTAAGTGAGGAGTGCAAGAGGCAGATGCTGACGGCTTCA
NM_173174.2       CAGCAGAACGCCGTGACCTCCCTAAGTGAGGAGTGCAAGAGGCAGATGCTGACGGCTTCA
NM_173176.2       CAGCAGAACGCCGTGACCTCCCTAAGTGAGGAGTGCAAGAGGCAGATGCTGACGGCTTCA
NM_173175.2       CAGCAGAACGCCGTGACCTCCCTAAGTGAGGAGTGCAAGAGGCAGATGCTGACGGCTTCA
                  ***********************.************************************

HsCD00037946      CACACCCTGGCTATGGACGCCAAGAACCTGCTCGACGCTGTGGACCAGGCCAAGGTTCTG
NM_004103.4       CACACCCTGGCTGTGGACGCCAAGAACCTGCTCGACGCTGTGGACCAGGCCAAGGTTCTG
NM_173174.2       CACACCCTGGCTGTGGACGCCAAGAACCTGCTCGACGCTGTGGACCAGGCCAAGGTTCTG
NM_173176.2       CACACCCTGGCTGTGGACGCCAAGAACCTGCTCGACGCTGTGGACCAGGCCAAGGTTCTG
NM_173175.2       CACACCCTGGCTGTGGACGCCAAGAACCTGCTCGACGCTGTGGACCAGGCCAAGGTTCTG
                  ************.***********************************************

HsCD00037946      GCCAATCTGGCCCACCCACCTGCAGAGTTG
NM_004103.4       GCCAATCTGGCCCACCCACCTGCAGAGTGA
NM_173174.2       GCCAATCTGGCCCACCCACCTGCAGAGTGA
NM_173176.2       GCCAATCTGGCCCACCCACCTGCAGAGTGA
NM_173175.2       GCCAATCTGGCCCACCCACCTGCAGAGTGA
                  **************************** .

Pathways

NCI : Alpha-synuclein signaling
NCI : Alpha4 beta1 integrin signaling events
NCI : CXCR4-mediated signaling events
NCI : Coregulation of Androgen receptor activity
NCI : Endothelins
NCI : FGF signaling pathway
NCI : IL2-mediated signaling events
NCI : Integrins in angiogenesis
NCI : LPA receptor mediated events
NCI : Osteopontin-mediated events
NCI : Signaling events mediated by VEGFR1 and VEGFR2
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Integrin signalling pathway
Reactome : Cell-Cell communication
Reactome : Cytokine Signaling in Immune system
Reactome : Immune System
Reactome : Interleukin-2 signaling
Reactome : Signal regulatory protein (SIRP) family interactions
Reactome : Signaling by Interleukins
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-7 signaling pathway
WikiPathway : Nifedipine Activity
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : angiogenesis overview

Clone

Cloning Information : 164620
HIP Master Clone ID : 124256
Original Clone ID : FLH164620.01L

Organism


TAX_ID : 9606
Species Specific ID: 2185

Genome

Chromosome : 8
Map Location : 8p21.1
Ensembl : ENSG00000120899

Reagents

Labome : PYK2-antibody