DNASU Plasmid Repository • 480.965.5697 | Email

BUB1B (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  BUB1B
Gene Name:  BUB1 mitotic checkpoint serine/threonine kinase B
Sequence             
Original Clone ID: FLH164623.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00037949

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3153nts         Open reading frame : 1 to 3153
Reference Sequence Alignment

ATGGCGGCGGTGAAGAAGGAAGGGGGTGTTCTGAGTGAAGCCATGTCCCTGGAGGGAGAT
GAATGGGAACTGAGTAAAGAAAATGTACAACCTTTAAGGCAAGGGCGGATCATGTCCACG
CTTCAGGGAGCACTGGCACAAGAATCTGCCTGTAACAATACTCTTCAGCAGCAGAAACGG
GCATTTGAATATGAAATTCGATTTTACACTGGAAATGACCCTCTGGATGTTTGGGATAGG
TATATCAGCTGGACAGAGCAGAACTATCCTCAAGGTGGGAAGGAGAGTAATATGTCAACG
TTATTAGAAAGAGCTGTAGAAGCACTACAAGGAGAAAAACGATATTATAGTGATCCTCGA
TTTCTCAATCTCTGGCTTAAATTAGGGCGTTTATGCAATGAGCCTTTGGATATGTACAGT
TACTTGCACAACCAAGGGATTGGTGTTTCACTTGCTCAGTTCTATATCTCATGGGCAGAA
GAATATGAAGCTAGAGAAAACTTTAGGAAAGCAGATGCGATATTTCAGGAAGGGATTCAA
CAGAAGGCTGAACCACTAGAAAGACTACAGTCCCAGCACCGACAATTCCAAGCTCGAGTG
TCTCGGCAAACTCTGTTGGCACTTGAGAAAGAAGAAGAGGAGGAAGTTTTTGAGTCTTCT
GTACCACAACGAAGCACACTAGCTGAACTAAAGAGCAAAGGGAAAAAGACAGCAAGAGCT
CCAATCATCCGTGTAGGAGGTGCTCTCAAGGCTCCAAGCCAGAACAGAGGACTCCAAAAT
CCATTTCCTCAACAGATGCAAAATAATAGTAGAATTACTGTTTTTGATGAAAATGCTGAT
GAGGCTTCTACAGCAGAGTTGTCTAAGCCTACAGTCCAGCCATGGATAGCACCCCCCATG
CCCAGGGCCAAAGAGAATGAGCTGCAAGCAGGCCCTTGGAACACAGGCAGGTCCTTGGAA
CACAGGCCTCGTGGCAATACAGCTTCACTGATAGCTGTACCCGCTGTGCTTCCCAGTTTC
ACTCCATATGTGGAAGAGACTGCACAACAGCCAGTTATGACACCATGTAAAATTGAACCT
AGTATAAACCACATCCTAAGCACCAGAAAGCCTGGAAAGGAAGAAGGAGATTCTCTACAA
AGGGTTCAGAGCCATCAGCAAGCGTCTGAGGAGAAGAAAGAGAAGATGATGTATTGTAAG
GAGAAGATTTATGCAGGAGTAGGGGAATTCTCCTTTGAAGAAATTCGGGCTGAAGTTTTC
CGGAAGAAATTAAAAGAGCAAAGGGAAGCCGAGCTATTGACCAGTGCAGAGAAGAGAGCA
GAAATGCAGAAACAGATTGAAGAGATGGAGAAGAAGCTAAAAGAAATCCAAACTACTCAG
CAAGAAAGAACAGGTGATCAGCAAGAAGAGACGATGCCTACAAAGGAGACAACTAAACTG
CAAATTGCTTCCGAGTCTCAGAAAATACCAGGAATGACTCTATCCAGTTCTGTTTGTCAA
GTAAACTGTTGTGCCAGAGAAACTTCACTTGCGGAGAACATTTGGCAGGAACAACCTCAT
TCTAAAGGTCCCAGTGTACCTTTCTCCATTTTTGATGAGTTTCTTCTTTCAGAAAAGAAG
AATAAAAGTCCTCCTGCAGATCCCCCACGAGTTTTAGCTCAACGAAGACCCCTTGCAGTT
CTCAAAACCTCAGAAAGCATCACCTCAAATGAAGATGTGTCTCCAGATGTTTGTGATGAA
TTTACAGGAATTGAACCCTTGAGCGAGGATGCCATTATCACAGGCTTCAGAAATGTAACA
ATTTGTCCTAACCCAGAAGACACTTGTGACTTTGCCAGAGCAGCTCGTTTTGTATCCACT
CCTTTTCATGAGATAATGTCCTTGAAGGATCTCCCTTCTGATCCTGAGAGACTGTTACCG
GAAGAAGATCTAGATGTAAAGACCTCTGAGGACCAGCAGACAGCTTGTGGCACTATCTAC
AGTCAGACTCTCAGCATCAAGAAGCTGAGCCCAATTATTGAAGACAGTCGTGAAGCCACA
CACTCCTCTGGCTTCTCTGGTTCTTCTGCCTCGGTTGCAAGCACCTCCTCCATCAAATGT
CTTCAAATTCCTGAGAAACTAGAACTTACTAATGAGACTTCAGAAAACCCTACTCAGTCA
CCATGGTGTTCACAGTATCGCAGACAGCTACTGAAGTCCCTACCAGAGTTAAGTGCCTCT
GCAGAGTTGTGTATAGAAGACAGACCAATGCCTAAGTTGGAAATTGAGAAGGAAATTGAA
TTAGGTAATGAGGATTACTGCATTAAACGAGAATACCTAATATGTGAAGATTACAAGTTA
TTCTGGGTGGCGCCAAGAAACTCTGCAGAATTAACAGTAATAAAGGTATCTTCTCAACCT
GTCCCATGGGACTTTTATATCAACCTCAAGTTAAAGGAACGTTTAAATGAAGATTTTGAT
CATTTTTGCAGCTGTTATCAATATCAAGATGGCTGTATTGTTTGGCACCAATATATAAAC
TGCTTCACCCTTCAGGATCTTCTCCAACACAGTGAATATATTACCCATGAAATAACAGTG
TTGATTATTTATAACCTTTTGACAATAGTGGAGATGCTACACAAAGCAGAAATAGTCCAT
GGTGACTTGAGTCCAAGGTGTCTGATTCTCAGAAACAGAATCCACGATCCCTATGATTGT
AACAAGAACAATCAAGCTTTGAAGATAGTGGACTTTTCCTACAGTGTTGACCTTAGGGTG
CAGCTGGATGTTTTTACCCTCAGCGGCTTTCGGACTGTACAGATCCTGGAAGGACAAAAG
ATCCTGGCTAACTGTTCTTCTCCCTACCAGGTAGACCTGTTTGGTATAGCAGATTTAGCA
CATTTACTATTGTTCAAGGAACACCTACAGGTCTTCTGGGATGGGTCCTTCTGGAAACTT
AGCCAAAATATTTCTGAGCTAAAAGATGGTGAATTGTGGAATAAATTCTTTGTGCGGATT
CTGAATGCCAATGATGAGGCCACAGTGTCTGTTCTTGGGGAGCTTGCAGCAGAAATGAAT
GGGGTTTTTGACACTACATTCCAAAGTCACCTGAACAAAGCCTTATGGAAGGTAGGGAAG
TTAACTAGTCCTGGGGCTTTGCTCTTTCAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 3195
Start on reference sequence 43
Mutations:
None
Discrepancy:
c29t,A10V; a282g; c1132t,P378S
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : BUB1B
Symbol Nomenclature : BUB1B
SYNONYM : BUB1beta; BUBR1; Bub1A; MAD3L; MVA1; SSK1; hBUBR1
Designation : MAD3/BUB1-related protein kinase|budding uninhibited by benzimidazoles 1 homolog beta|mitotic checkpoint kinase MAD3L|mitotic checkpoint serine/threonine-protein kinase BUB1 beta
Full Nomenclature : BUB1 mitotic checkpoint serine/threonine kinase B
GENEID : 701
HGNC : 1149
MIM : 602860
Vega : OTTHUMG00000129877
Target GenBank: NM_001211

 

Reference Sequence Alignment

  

HsCD00037949      ATGGCGGCGGTGAAGAAGGAAGGGGGTGTTCTGAGTGAAGCCATGTCCCTGGAGGGAGAT
NM_001211.5       ATGGCGGCGGTGAAGAAGGAAGGGGGTGCTCTGAGTGAAGCCATGTCCCTGGAGGGAGAT
                  **************************** *******************************

HsCD00037949      GAATGGGAACTGAGTAAAGAAAATGTACAACCTTTAAGGCAAGGGCGGATCATGTCCACG
NM_001211.5       GAATGGGAACTGAGTAAAGAAAATGTACAACCTTTAAGGCAAGGGCGGATCATGTCCACG
                  ************************************************************

HsCD00037949      CTTCAGGGAGCACTGGCACAAGAATCTGCCTGTAACAATACTCTTCAGCAGCAGAAACGG
NM_001211.5       CTTCAGGGAGCACTGGCACAAGAATCTGCCTGTAACAATACTCTTCAGCAGCAGAAACGG
                  ************************************************************

HsCD00037949      GCATTTGAATATGAAATTCGATTTTACACTGGAAATGACCCTCTGGATGTTTGGGATAGG
NM_001211.5       GCATTTGAATATGAAATTCGATTTTACACTGGAAATGACCCTCTGGATGTTTGGGATAGG
                  ************************************************************

HsCD00037949      TATATCAGCTGGACAGAGCAGAACTATCCTCAAGGTGGGAAGGAGAGTAATATGTCAACG
NM_001211.5       TATATCAGCTGGACAGAGCAGAACTATCCTCAAGGTGGGAAGGAGAGTAATATGTCAACG
                  ************************************************************

HsCD00037949      TTATTAGAAAGAGCTGTAGAAGCACTACAAGGAGAAAAACGATATTATAGTGATCCTCGA
NM_001211.5       TTATTAGAAAGAGCTGTAGAAGCACTACAAGGAGAAAAACGATATTATAGTGATCCTCGA
                  ************************************************************

HsCD00037949      TTTCTCAATCTCTGGCTTAAATTAGGGCGTTTATGCAATGAGCCTTTGGATATGTACAGT
NM_001211.5       TTTCTCAATCTCTGGCTTAAATTAGGGCGTTTATGCAATGAGCCTTTGGATATGTACAGT
                  ************************************************************

HsCD00037949      TACTTGCACAACCAAGGGATTGGTGTTTCACTTGCTCAGTTCTATATCTCATGGGCAGAA
NM_001211.5       TACTTGCACAACCAAGGGATTGGTGTTTCACTTGCTCAGTTCTATATCTCATGGGCAGAA
                  ************************************************************

HsCD00037949      GAATATGAAGCTAGAGAAAACTTTAGGAAAGCAGATGCGATATTTCAGGAAGGGATTCAA
NM_001211.5       GAATATGAAGCTAGAGAAAACTTTAGGAAAGCAGATGCGATATTTCAGGAAGGGATTCAA
                  ************************************************************

HsCD00037949      CAGAAGGCTGAACCACTAGAAAGACTACAGTCCCAGCACCGACAATTCCAAGCTCGAGTG
NM_001211.5       CAGAAGGCTGAACCACTAGAAAGACTACAGTCCCAGCACCGACAATTCCAAGCTCGAGTG
                  ************************************************************

HsCD00037949      TCTCGGCAAACTCTGTTGGCACTTGAGAAAGAAGAAGAGGAGGAAGTTTTTGAGTCTTCT
NM_001211.5       TCTCGGCAAACTCTGTTGGCACTTGAGAAAGAAGAAGAGGAGGAAGTTTTTGAGTCTTCT
                  ************************************************************

HsCD00037949      GTACCACAACGAAGCACACTAGCTGAACTAAAGAGCAAAGGGAAAAAGACAGCAAGAGCT
NM_001211.5       GTACCACAACGAAGCACACTAGCTGAACTAAAGAGCAAAGGGAAAAAGACAGCAAGAGCT
                  ************************************************************

HsCD00037949      CCAATCATCCGTGTAGGAGGTGCTCTCAAGGCTCCAAGCCAGAACAGAGGACTCCAAAAT
NM_001211.5       CCAATCATCCGTGTAGGAGGTGCTCTCAAGGCTCCAAGCCAGAACAGAGGACTCCAAAAT
                  ************************************************************

HsCD00037949      CCATTTCCTCAACAGATGCAAAATAATAGTAGAATTACTGTTTTTGATGAAAATGCTGAT
NM_001211.5       CCATTTCCTCAACAGATGCAAAATAATAGTAGAATTACTGTTTTTGATGAAAATGCTGAT
                  ************************************************************

HsCD00037949      GAGGCTTCTACAGCAGAGTTGTCTAAGCCTACAGTCCAGCCATGGATAGCACCCCCCATG
NM_001211.5       GAGGCTTCTACAGCAGAGTTGTCTAAGCCTACAGTCCAGCCATGGATAGCACCCCCCATG
                  ************************************************************

HsCD00037949      CCCAGGGCCAAAGAGAATGAGCTGCAAGCAGGCCCTTGGAACACAGGCAGGTCCTTGGAA
NM_001211.5       CCCAGGGCCAAAGAGAATGAGCTGCAAGCAGGCCCTTGGAACACAGGCAGGTCCTTGGAA
                  ************************************************************

HsCD00037949      CACAGGCCTCGTGGCAATACAGCTTCACTGATAGCTGTACCCGCTGTGCTTCCCAGTTTC
NM_001211.5       CACAGGCCTCGTGGCAATACAGCTTCACTGATAGCTGTACCCGCTGTGCTTCCCAGTTTC
                  ************************************************************

HsCD00037949      ACTCCATATGTGGAAGAGACTGCACAACAGCCAGTTATGACACCATGTAAAATTGAACCT
NM_001211.5       ACTCCATATGTGGAAGAGACTGCACAACAGCCAGTTATGACACCATGTAAAATTGAACCT
                  ************************************************************

HsCD00037949      AGTATAAACCACATCCTAAGCACCAGAAAGCCTGGAAAGGAAGAAGGAGATTCTCTACAA
NM_001211.5       AGTATAAACCACATCCTAAGCACCAGAAAGCCTGGAAAGGAAGAAGGAGATCCTCTACAA
                  *************************************************** ********

HsCD00037949      AGGGTTCAGAGCCATCAGCAAGCGTCTGAGGAGAAGAAAGAGAAGATGATGTATTGTAAG
NM_001211.5       AGGGTTCAGAGCCATCAGCAAGCGTCTGAGGAGAAGAAAGAGAAGATGATGTATTGTAAG
                  ************************************************************

HsCD00037949      GAGAAGATTTATGCAGGAGTAGGGGAATTCTCCTTTGAAGAAATTCGGGCTGAAGTTTTC
NM_001211.5       GAGAAGATTTATGCAGGAGTAGGGGAATTCTCCTTTGAAGAAATTCGGGCTGAAGTTTTC
                  ************************************************************

HsCD00037949      CGGAAGAAATTAAAAGAGCAAAGGGAAGCCGAGCTATTGACCAGTGCAGAGAAGAGAGCA
NM_001211.5       CGGAAGAAATTAAAAGAGCAAAGGGAAGCCGAGCTATTGACCAGTGCAGAGAAGAGAGCA
                  ************************************************************

HsCD00037949      GAAATGCAGAAACAGATTGAAGAGATGGAGAAGAAGCTAAAAGAAATCCAAACTACTCAG
NM_001211.5       GAAATGCAGAAACAGATTGAAGAGATGGAGAAGAAGCTAAAAGAAATCCAAACTACTCAG
                  ************************************************************

HsCD00037949      CAAGAAAGAACAGGTGATCAGCAAGAAGAGACGATGCCTACAAAGGAGACAACTAAACTG
NM_001211.5       CAAGAAAGAACAGGTGATCAGCAAGAAGAGACGATGCCTACAAAGGAGACAACTAAACTG
                  ************************************************************

HsCD00037949      CAAATTGCTTCCGAGTCTCAGAAAATACCAGGAATGACTCTATCCAGTTCTGTTTGTCAA
NM_001211.5       CAAATTGCTTCCGAGTCTCAGAAAATACCAGGAATGACTCTATCCAGTTCTGTTTGTCAA
                  ************************************************************

HsCD00037949      GTAAACTGTTGTGCCAGAGAAACTTCACTTGCGGAGAACATTTGGCAGGAACAACCTCAT
NM_001211.5       GTAAACTGTTGTGCCAGAGAAACTTCACTTGCGGAGAACATTTGGCAGGAACAACCTCAT
                  ************************************************************

HsCD00037949      TCTAAAGGTCCCAGTGTACCTTTCTCCATTTTTGATGAGTTTCTTCTTTCAGAAAAGAAG
NM_001211.5       TCTAAAGGTCCCAGTGTACCTTTCTCCATTTTTGATGAGTTTCTTCTTTCAGAAAAGAAG
                  ************************************************************

HsCD00037949      AATAAAAGTCCTCCTGCAGATCCCCCACGAGTTTTAGCTCAACGAAGACCCCTTGCAGTT
NM_001211.5       AATAAAAGTCCTCCTGCAGATCCCCCACGAGTTTTAGCTCAACGAAGACCCCTTGCAGTT
                  ************************************************************

HsCD00037949      CTCAAAACCTCAGAAAGCATCACCTCAAATGAAGATGTGTCTCCAGATGTTTGTGATGAA
NM_001211.5       CTCAAAACCTCAGAAAGCATCACCTCAAATGAAGATGTGTCTCCAGATGTTTGTGATGAA
                  ************************************************************

HsCD00037949      TTTACAGGAATTGAACCCTTGAGCGAGGATGCCATTATCACAGGCTTCAGAAATGTAACA
NM_001211.5       TTTACAGGAATTGAACCCTTGAGCGAGGATGCCATTATCACAGGCTTCAGAAATGTAACA
                  ************************************************************

HsCD00037949      ATTTGTCCTAACCCAGAAGACACTTGTGACTTTGCCAGAGCAGCTCGTTTTGTATCCACT
NM_001211.5       ATTTGTCCTAACCCAGAAGACACTTGTGACTTTGCCAGAGCAGCTCGTTTTGTATCCACT
                  ************************************************************

HsCD00037949      CCTTTTCATGAGATAATGTCCTTGAAGGATCTCCCTTCTGATCCTGAGAGACTGTTACCG
NM_001211.5       CCTTTTCATGAGATAATGTCCTTGAAGGATCTCCCTTCTGATCCTGAGAGACTGTTACCG
                  ************************************************************

HsCD00037949      GAAGAAGATCTAGATGTAAAGACCTCTGAGGACCAGCAGACAGCTTGTGGCACTATCTAC
NM_001211.5       GAAGAAGATCTAGATGTAAAGACCTCTGAGGACCAGCAGACAGCTTGTGGCACTATCTAC
                  ************************************************************

HsCD00037949      AGTCAGACTCTCAGCATCAAGAAGCTGAGCCCAATTATTGAAGACAGTCGTGAAGCCACA
NM_001211.5       AGTCAGACTCTCAGCATCAAGAAGCTGAGCCCAATTATTGAAGACAGTCGTGAAGCCACA
                  ************************************************************

HsCD00037949      CACTCCTCTGGCTTCTCTGGTTCTTCTGCCTCGGTTGCAAGCACCTCCTCCATCAAATGT
NM_001211.5       CACTCCTCTGGCTTCTCTGGTTCTTCTGCCTCGGTTGCAAGCACCTCCTCCATCAAATGT
                  ************************************************************

HsCD00037949      CTTCAAATTCCTGAGAAACTAGAACTTACTAATGAGACTTCAGAAAACCCTACTCAGTCA
NM_001211.5       CTTCAAATTCCTGAGAAACTAGAACTTACTAATGAGACTTCAGAAAACCCTACTCAGTCA
                  ************************************************************

HsCD00037949      CCATGGTGTTCACAGTATCGCAGACAGCTACTGAAGTCCCTACCAGAGTTAAGTGCCTCT
NM_001211.5       CCATGGTGTTCACAGTATCGCAGACAGCTACTGAAGTCCCTACCAGAGTTAAGTGCCTCT
                  ************************************************************

HsCD00037949      GCAGAGTTGTGTATAGAAGACAGACCAATGCCTAAGTTGGAAATTGAGAAGGAAATTGAA
NM_001211.5       GCAGAGTTGTGTATAGAAGACAGACCAATGCCTAAGTTGGAAATTGAGAAGGAAATTGAA
                  ************************************************************

HsCD00037949      TTAGGTAATGAGGATTACTGCATTAAACGAGAATACCTAATATGTGAAGATTACAAGTTA
NM_001211.5       TTAGGTAATGAGGATTACTGCATTAAACGAGAATACCTAATATGTGAAGATTACAAGTTA
                  ************************************************************

HsCD00037949      TTCTGGGTGGCGCCAAGAAACTCTGCAGAATTAACAGTAATAAAGGTATCTTCTCAACCT
NM_001211.5       TTCTGGGTGGCGCCAAGAAACTCTGCAGAATTAACAGTAATAAAGGTATCTTCTCAACCT
                  ************************************************************

HsCD00037949      GTCCCATGGGACTTTTATATCAACCTCAAGTTAAAGGAACGTTTAAATGAAGATTTTGAT
NM_001211.5       GTCCCATGGGACTTTTATATCAACCTCAAGTTAAAGGAACGTTTAAATGAAGATTTTGAT
                  ************************************************************

HsCD00037949      CATTTTTGCAGCTGTTATCAATATCAAGATGGCTGTATTGTTTGGCACCAATATATAAAC
NM_001211.5       CATTTTTGCAGCTGTTATCAATATCAAGATGGCTGTATTGTTTGGCACCAATATATAAAC
                  ************************************************************

HsCD00037949      TGCTTCACCCTTCAGGATCTTCTCCAACACAGTGAATATATTACCCATGAAATAACAGTG
NM_001211.5       TGCTTCACCCTTCAGGATCTTCTCCAACACAGTGAATATATTACCCATGAAATAACAGTG
                  ************************************************************

HsCD00037949      TTGATTATTTATAACCTTTTGACAATAGTGGAGATGCTACACAAAGCAGAAATAGTCCAT
NM_001211.5       TTGATTATTTATAACCTTTTGACAATAGTGGAGATGCTACACAAAGCAGAAATAGTCCAT
                  ************************************************************

HsCD00037949      GGTGACTTGAGTCCAAGGTGTCTGATTCTCAGAAACAGAATCCACGATCCCTATGATTGT
NM_001211.5       GGTGACTTGAGTCCAAGGTGTCTGATTCTCAGAAACAGAATCCACGATCCCTATGATTGT
                  ************************************************************

HsCD00037949      AACAAGAACAATCAAGCTTTGAAGATAGTGGACTTTTCCTACAGTGTTGACCTTAGGGTG
NM_001211.5       AACAAGAACAATCAAGCTTTGAAGATAGTGGACTTTTCCTACAGTGTTGACCTTAGGGTG
                  ************************************************************

HsCD00037949      CAGCTGGATGTTTTTACCCTCAGCGGCTTTCGGACTGTACAGATCCTGGAAGGACAAAAG
NM_001211.5       CAGCTGGATGTTTTTACCCTCAGCGGCTTTCGGACTGTACAGATCCTGGAAGGACAAAAG
                  ************************************************************

HsCD00037949      ATCCTGGCTAACTGTTCTTCTCCCTACCAGGTAGACCTGTTTGGTATAGCAGATTTAGCA
NM_001211.5       ATCCTGGCTAACTGTTCTTCTCCCTACCAGGTAGACCTGTTTGGTATAGCAGATTTAGCA
                  ************************************************************

HsCD00037949      CATTTACTATTGTTCAAGGAACACCTACAGGTCTTCTGGGATGGGTCCTTCTGGAAACTT
NM_001211.5       CATTTACTATTGTTCAAGGAACACCTACAGGTCTTCTGGGATGGGTCCTTCTGGAAACTT
                  ************************************************************

HsCD00037949      AGCCAAAATATTTCTGAGCTAAAAGATGGTGAATTGTGGAATAAATTCTTTGTGCGGATT
NM_001211.5       AGCCAAAATATTTCTGAGCTAAAAGATGGTGAATTGTGGAATAAATTCTTTGTGCGGATT
                  ************************************************************

HsCD00037949      CTGAATGCCAATGATGAGGCCACAGTGTCTGTTCTTGGGGAGCTTGCAGCAGAAATGAAT
NM_001211.5       CTGAATGCCAATGATGAGGCCACAGTGTCTGTTCTTGGGGAGCTTGCAGCAGAAATGAAT
                  ************************************************************

HsCD00037949      GGGGTTTTTGACACTACATTCCAAAGTCACCTGAACAAAGCCTTATGGAAGGTAGGGAAG
NM_001211.5       GGGGTTTTTGACACTACATTCCAAAGTCACCTGAACAAAGCCTTATGGAAGGTAGGGAAG
                  ************************************************************

HsCD00037949      TTAACTAGTCCTGGGGCTTTGCTCTTTCAGTTG
NM_001211.5       TTAACTAGTCCTGGGGCTTTGCTCTTTCAGTGA
                  ******************************* .

Pathways

NCI : PLK1 signaling events
Reactome : APC-Cdc20 mediated degradation of Nek2A
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Cdc20:Phospho-APC/C mediated degradation of Cyclin A
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Inactivation of APC/C via direct inhibition of the APC/C complex
Reactome : Inhibition of the proteolytic activity of APC/C required for the onset of anaphase by mitotic spindle checkpoint components
Reactome : M Phase
Reactome : Mitotic Anaphase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Prometaphase
Reactome : Mitotic Spindle Checkpoint
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of mitotic cell cycle
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : Separation of Sister Chromatids
WikiPathway : Cell cycle

Protein

SMART domain : Mad3_BUB1_I : Mad3/BUB1 hoMad3/BUB1 homology region 1
UniProt : O60566
HPRD : 04176

Clone

Cloning Information : 164623
HIP Master Clone ID : 124261
Original Clone ID : FLH164623.01L

Organism


TAX_ID : 9606
Species Specific ID: 701

Genome

Chromosome : 15
Map Location : 15q15
Ensembl : ENSG00000156970

Reagents

Labome : BUB1B-antibody