DNASU Plasmid Repository • 480.965.5697 | Email

CSNK1D (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CSNK1D
Gene Name:  casein kinase 1, delta
Sequence             
Original Clone ID: FLH138520.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00037957

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1248nts         Open reading frame : 1 to 1248
Reference Sequence Alignment

ATGGAGCTGAGAGTCGGGAACAGGTACCGGCTGGGCCGGAAGATCGGCAGCGGCTCCTTC
GGAGACATCTATCTCGGTACGGACATTGCTGCAGGAGAAGAGGTTGCCATCAAGCTTGAA
TGTGTCAAAACCAAACACCCTCAGCTCCACATTGAGAGCAAAATCTACAAGATGATGCAG
GGAGGAGTGGGCATCCCCACCATCAGATGGTGCGGGGCAGAGGGGGACTACAACGTCATG
GTGATGGAGCTGCTGGGGCCAAGCCTGGAGGACCTCTTCAACTTCTGCTCCAGGAAATTC
AGCCTCAAAACCGTCCTGCTGCTTGCTGACCAAATGATCAGTCGCATCGAATACATTCAT
TCAAAGAACTTCATCCACCGGGATGTGAAGCCAGACAACTTCCTCATGGGCCTGGGGAAG
AAGGGCAACCTGGTGTACATCATCGACTTCGGGCTGGCCAAGAAGTACCGGGATGCACGC
ACCCACCAGCACATCCCCTATCGTGAGAACAAGAACCTCACGGGGACGGCGCGGTACGCC
TCCATCAACACGCACCTTGGAATTGAACAATCCCGAAGAGATGACTTGGAGTCTCTGGGC
TACGTGCTAATGTACTTCAACCTGGGCTCTCTCCCCTGGCAGGGGCTGAAGGCTGCCACC
AAGAGACAGAAATACGAAAGGATTAGCGAGAAGAAAATGTCCACCCCCATCGAAGTGTTG
TGTAAAGGCTACCCTTCCGAATTTGCCACATACCTGAATTTCTGCCGTTCCTTGCGTTTT
GACGACAAGCCTGACTACTCGTACCTGCGGCAGCTTTTCCGGAATCTGTTCCATCGCCAG
GGCTTCTCCTATGACTACGTGTTCGACTGGAACATGCTCAAATTTGGTGCCAGCCGGGCC
GCCGATGACGCCGAGCGGGAGCGCAGGGACCGAGAGGAGCGGCTGAGACACTCGCGGAAC
CCGGCTACCCGCGGCCTCCCTTCCACAGCCTCCGGCCGCCTGCGGGGGACGCAGGAAGTG
GCTCCCCCCACACCCCTCACCCCTACCTCACACACGGCTAACACCTCCCCCCGGCCTGTC
TCCGGCATGGAGAGAGAGCGGAAAGTGAGTATGCGGCTGCACCGCGGGGCCCCCGTCAAC
ATCTCCTCGTCCGACCTCACAGGCCGACAAGATACCTCTCGCATGTCCACCTCACAGATT
CCTGGTCGGGTGGCTTCCAGTGGTCTTCAGTCTGTCGTGCACCGATTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1556
Start on reference sequence 309
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CSNK1D
Symbol Nomenclature : CSNK1D
SYNONYM : ASPS; CKIdelta; FASPS2; HCKID
Designation : CKI-delta|CKId|casein kinase I isoform delta|tau-protein kinase CSNK1D
Full Nomenclature : casein kinase 1, delta
GENEID : 1453
HGNC : 2452
MIM : 600864
Vega : OTTHUMG00000178601
Target GenBank: BC003558

 

Reference Sequence Alignment

  

HsCD00037957        ATGGAGCTGAGAGTCGGGAACAGGTACCGGCTGGGCCGGAAGATCGGCAGCGGCTCCTTC
XM_005256336.1      ATGGAGCTGAGAGTCGGGAACAGGTACCGGCTGGGCCGGAAGATCGGCAGCGGCTCCTTC
NM_139062.2         ATGGAGCTGAGAGTCGGGAACAGGTACCGGCTGGGCCGGAAGATCGGCAGCGGCTCCTTC
NM_001893.4         ATGGAGCTGAGAGTCGGGAACAGGTACCGGCTGGGCCGGAAGATCGGCAGCGGCTCCTTC
                    ************************************************************

HsCD00037957        GGAGACATCTATCTCGGTACGGACATTGCTGCAGGAGAAGAGGTTGCCATCAAGCTTGAA
XM_005256336.1      GGAGACATCTATCTCGGTACGGACATTGCTGCAGGAGAAGAGGTTGCCATCAAGCTTGAA
NM_139062.2         GGAGACATCTATCTCGGTACGGACATTGCTGCAGGAGAAGAGGTTGCCATCAAGCTTGAA
NM_001893.4         GGAGACATCTATCTCGGTACGGACATTGCTGCAGGAGAAGAGGTTGCCATCAAGCTTGAA
                    ************************************************************

HsCD00037957        TGTGTCAAAACCAAACACCCTCAGCTCCACATTGAGAGCAAAATCTACAAGATGATGCAG
XM_005256336.1      TGTGTCAAAACCAAACACCCTCAGCTCCACATTGAGAGCAAAATCTACAAGATGATGCAG
NM_139062.2         TGTGTCAAAACCAAACACCCTCAGCTCCACATTGAGAGCAAAATCTACAAGATGATGCAG
NM_001893.4         TGTGTCAAAACCAAACACCCTCAGCTCCACATTGAGAGCAAAATCTACAAGATGATGCAG
                    ************************************************************

HsCD00037957        GGAGGAGTGGGCATCCCCACCATCAGATGGTGCGGGGCAGAGGGGGACTACAACGTCATG
XM_005256336.1      GGAGGAGTGGGCATCCCCACCATCAGATGGTGCGGGGCAGAGGGGGACTACAACGTCATG
NM_139062.2         GGAGGAGTGGGCATCCCCACCATCAGATGGTGCGGGGCAGAGGGGGACTACAACGTCATG
NM_001893.4         GGAGGAGTGGGCATCCCCACCATCAGATGGTGCGGGGCAGAGGGGGACTACAACGTCATG
                    ************************************************************

HsCD00037957        GTGATGGAGCTGCTGGGGCCAAGCCTGGAGGACCTCTTCAACTTCTGCTCCAGGAAATTC
XM_005256336.1      GTGATGGAGCTGCTGGGGCCAAGCCTGGAGGACCTCTTCAACTTCTGCTCCAGGAAATTC
NM_139062.2         GTGATGGAGCTGCTGGGGCCAAGCCTGGAGGACCTCTTCAACTTCTGCTCCAGGAAATTC
NM_001893.4         GTGATGGAGCTGCTGGGGCCAAGCCTGGAGGACCTCTTCAACTTCTGCTCCAGGAAATTC
                    ************************************************************

HsCD00037957        AGCCTCAAAACCGTCCTGCTGCTTGCTGACCAAATGATCAGTCGCATCGAATACATTCAT
XM_005256336.1      AGCCTCAAAACCGTCCTGCTGCTTGCTGACCAAATGATCAGTCGCATCGAATACATTCAT
NM_139062.2         AGCCTCAAAACCGTCCTGCTGCTTGCTGACCAAATGATCAGTCGCATCGAATACATTCAT
NM_001893.4         AGCCTCAAAACCGTCCTGCTGCTTGCTGACCAAATGATCAGTCGCATCGAATACATTCAT
                    ************************************************************

HsCD00037957        TCAAAGAACTTCATCCACCGGGATGTGAAGCCAGACAACTTCCTCATGGGCCTGGGGAAG
XM_005256336.1      TCAAAGAACTTCATCCACCGGGATGTGAAGCCAGACAACTTCCTCATGGGCCTGGGGAAG
NM_139062.2         TCAAAGAACTTCATCCACCGGGATGTGAAGCCAGACAACTTCCTCATGGGCCTGGGGAAG
NM_001893.4         TCAAAGAACTTCATCCACCGGGATGTGAAGCCAGACAACTTCCTCATGGGCCTGGGGAAG
                    ************************************************************

HsCD00037957        AAGGGCAACCTGGTGTACATCATCGACTTCGGGCTGGCCAAGAAGTACCGGGATGCACGC
XM_005256336.1      AAGGGCAACCTGGTGTACATCATCGACTTCGGGCTGGCCAAGAAGTACCGGGATGCACGC
NM_139062.2         AAGGGCAACCTGGTGTACATCATCGACTTCGGGCTGGCCAAGAAGTACCGGGATGCACGC
NM_001893.4         AAGGGCAACCTGGTGTACATCATCGACTTCGGGCTGGCCAAGAAGTACCGGGATGCACGC
                    ************************************************************

HsCD00037957        ACCCACCAGCACATCCCCTATCGTGAGAACAAGAACCTCACGGGGACGGCGCGGTACGCC
XM_005256336.1      ACCCACCAGCACATCCCCTATCGTGAGAACAAGAACCTCACGGGGACGGCGCGGTACGCC
NM_139062.2         ACCCACCAGCACATCCCCTATCGTGAGAACAAGAACCTCACGGGGACGGCGCGGTACGCC
NM_001893.4         ACCCACCAGCACATCCCCTATCGTGAGAACAAGAACCTCACGGGGACGGCGCGGTACGCC
                    ************************************************************

HsCD00037957        TCCATCAACACGCACCTTGGAATTGAACAATCCCGAAGAGATGACTTGGAGTCTCTGGGC
XM_005256336.1      TCCATCAACACGCACCTTGGAATTGAACAATCCCGAAGAGATGACTTGGAGTCTCTGGGC
NM_139062.2         TCCATCAACACGCACCTTGGAATTGAACAATCCCGAAGAGATGACTTGGAGTCTCTGGGC
NM_001893.4         TCCATCAACACGCACCTTGGAATTGAACAATCCCGAAGAGATGACTTGGAGTCTCTGGGC
                    ************************************************************

HsCD00037957        TACGTGCTAATGTACTTCAACCTGGGCTCTCTCCCCTGGCAGGGGCTGAAGGCTGCCACC
XM_005256336.1      TACGTGCTAATGTACTTCAACCTGGGCTCTCTCCCCTGGCAGGGGCTGAAGGCTGCCACC
NM_139062.2         TACGTGCTAATGTACTTCAACCTGGGCTCTCTCCCCTGGCAGGGGCTGAAGGCTGCCACC
NM_001893.4         TACGTGCTAATGTACTTCAACCTGGGCTCTCTCCCCTGGCAGGGGCTGAAGGCTGCCACC
                    ************************************************************

HsCD00037957        AAGAGACAGAAATACGAAAGGATTAGCGAGAAGAAAATGTCCACCCCCATCGAAGTGTTG
XM_005256336.1      AAGAGACAGAAATACGAAAGGATTAGCGAGAAGAAAATGTCCACCCCCATCGAAGTGTTG
NM_139062.2         AAGAGACAGAAATACGAAAGGATTAGCGAGAAGAAAATGTCCACCCCCATCGAAGTGTTG
NM_001893.4         AAGAGACAGAAATACGAAAGGATTAGCGAGAAGAAAATGTCCACCCCCATCGAAGTGTTG
                    ************************************************************

HsCD00037957        TGTAAAGGCTACCCTTCCGAATTTGCCACATACCTGAATTTCTGCCGTTCCTTGCGTTTT
XM_005256336.1      TGTAAAGGCTACCCTTCCGAATTTGCCACATACCTGAATTTCTGCCGTTCCTTGCGTTTT
NM_139062.2         TGTAAAGGCTACCCTTCCGAATTTGCCACATACCTGAATTTCTGCCGTTCCTTGCGTTTT
NM_001893.4         TGTAAAGGCTACCCTTCCGAATTTGCCACATACCTGAATTTCTGCCGTTCCTTGCGTTTT
                    ************************************************************

HsCD00037957        GACGACAAGCCTGACTACTCGTACCTGCGGCAGCTTTTCCGGAATCTGTTCCATCGCCAG
XM_005256336.1      GACGACAAGCCTGACTACTCGTACCTGCGGCAGCTTTTCCGGAATCTGTTCCATCGCCAG
NM_139062.2         GACGACAAGCCTGACTACTCGTACCTGCGGCAGCTTTTCCGGAATCTGTTCCATCGCCAG
NM_001893.4         GACGACAAGCCTGACTACTCGTACCTGCGGCAGCTTTTCCGGAATCTGTTCCATCGCCAG
                    ************************************************************

HsCD00037957        GGCTTCTCCTATGACTACGTGTTCGACTGGAACATGCTCAAATTTGGTGCCAGCCGGGCC
XM_005256336.1      GGCTTCTCCTATGACTACGTGTTCGACTGGAACATGCTCAAATTTGGTGCCAGCCGGGCC
NM_139062.2         GGCTTCTCCTATGACTACGTGTTCGACTGGAACATGCTCAAATTTGGTGCCAGCCGGGCC
NM_001893.4         GGCTTCTCCTATGACTACGTGTTCGACTGGAACATGCTCAAATTTGGTGCCAGCCGGGCC
                    ************************************************************

HsCD00037957        GCCGATGACGCCGAGCGGGAGCGCAGGGACCGAGAGGAGCGGCTGAGACACTCGCGGAAC
XM_005256336.1      GCCGATGACGCCGAGCGGGAGCGCAGGGACCGAGAGGAGCGGCTGAGACACTCGCGGAAC
NM_139062.2         GCCGATGACGCCGAGCGGGAGCGCAGGGACCGAGAGGAGCGGCTGAGACACTCGCGGAAC
NM_001893.4         GCCGATGACGCCGAGCGGGAGCGCAGGGACCGAGAGGAGCGGCTGAGACACTCGCGGAAC
                    ************************************************************

HsCD00037957        CCGGCTACCCGCGGCCTCCCTTCCACAGCCTCCGGCCGCCTGCGGGGGACGCAGGAAGTG
XM_005256336.1      CCGGCTACCCGCGGCCTCCCTTCCACAGCCTCCGGCCGCCTGCGGGGGACGCAGGAAGTG
NM_139062.2         CCGGCTACCCGCGGCCTCCCTTCCACAGCCTCCGGCCGCCTGCGGGGGACGCAGGAAGTG
NM_001893.4         CCGGCTACCCGCGGCCTCCCTTCCACAGCCTCCGGCCGCCTGCGGGGGACGCAGGAAGTG
                    ************************************************************

HsCD00037957        GCTCCCCCCACACCCCTCACCCCTACCTCACACACGGCTAACACCTCCCCCCGGCCTGTC
XM_005256336.1      GCTCCCCCCACACCCCTCACCCCTACCTCACACACGGCTAACACCTCCCCCCGGCCCGTC
NM_139062.2         GCTCCCCCCACACCCCTCACCCCTACCTCACACACGGCTAACACCTCCCCCCGGCCCGTC
NM_001893.4         GCTCCCCCCACACCCCTCACCCCTACCTCACACACGGCTAACACCTCCCCCCGGCCCGTC
                    ******************************************************** ***

HsCD00037957        TCCGGCATGGAGAGAGAGCGGAAAGTGAGTATGCGGCTGCACCGCGGGGCCCCCGTCAAC
XM_005256336.1      TCCGGCATGGAGAGAGAGCGGAAAGTGAGTATGCGGCTGCACCGCGGGGCCCCCGTCAAC
NM_139062.2         TCCGGCATGGAGAGAGAGCGGAAAGTGAGTATGCGGCTGCACCGCGGGGCCCCCGTCAAC
NM_001893.4         TCCGGCATGGAGAGAGAGCGGAAAGTGAGTATGCGGCTGCACCGCGGGGCCCCCGTCAAC
                    ************************************************************

HsCD00037957        ATCTCCTCGTCCGACCTCACAGGCCGACAAGATACCTCTCGCATGTCCACCTCACAGATT
XM_005256336.1      ATCTCCTCGTCCGACCTCACAGGCCGACAAGATACCTCTCGCATGTCCACCTCACAGGTA
NM_139062.2         ATCTCCTCGTCCGACCTCACAGGCCGACAAGATACCTCTCGCATGTCCACCTCACAGAAT
NM_001893.4         ATCTCCTCGTCCGACCTCACAGGCCGACAAGATACCTCTCGCATGTCCACCTCACAGATT
                    *********************************************************.::

HsCD00037957        CCTGGTCGGGTGGCTTCCAGTGGTCTTCAGTCTGTCGTGCACCGATTG------------
XM_005256336.1      GGTGCAGAGCTCCCGGGCGGGCGCTGGGCCTCGGGCTACCCCGTCCGAGTCAAGAGCGGG
NM_139062.2         AGCATTCCTTTCGAACACCACGGCAAGTAG------------------------------
NM_001893.4         CCTGGTCGGGTGGCTTCCAGTGGTCTTCAGTCTGTCGTGCACCGATGA------------
                       . :    *  .   * .  *     .                               

HsCD00037957        ------------------------------------------------------------
XM_005256336.1      CTGTGGTTTCTCCAGGGCTTCTTCTTTCCTTTCTTCCCCCCATTTTTGAGAGTTTTTAAT
NM_139062.2         ------------------------------------------------------------
NM_001893.4         ------------------------------------------------------------
                                                                                

HsCD00037957        ---------------------------------
XM_005256336.1      CTCGCCAGGGTGTGGCGTCTTGGTTGCAGATGA
NM_139062.2         ---------------------------------
NM_001893.4         ---------------------------------
                                                     

Pathways

NCI : Degradation of beta catenin
NCI : FoxO family signaling
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : p53 pathway
Panther : Circadian clock system
Panther : Parkinson disease
Panther : Wnt signaling pathway
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Centrosome maturation
Reactome : Circadian Clock
Reactome : G2/M Transition
Reactome : Loss of Nlp from mitotic centrosomes
Reactome : Loss of proteins required for interphase microtubule organizationÿ from the centrosome
Reactome : Mitotic G2-G2/M phases
Reactome : Recruitment of mitotic centrosome proteins and complexes
Reactome : Regulation of PLK1 Activity at G2/M Transition
WikiPathway : Epithelium TarBase
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase

Clone

Cloning Information : 138520
HIP Master Clone ID : 87184
Original Clone ID : FLH138520.01L

Organism


TAX_ID : 9606
Species Specific ID: 1453

Genome

Chromosome : 17
Map Location : 17q25
Ensembl : ENSG00000141551

Reagents

Labome : CSNK1D-antibody