DNASU Plasmid Repository • 480.965.5697 | Email

STK11 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  STK11
Gene Name:  serine/threonine kinase 11
Sequence             
Original Clone ID: FLH138524.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00037961

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1302nts         Open reading frame : 1 to 1302
Reference Sequence Alignment

ATGGAGGTGGTGGACCCGCAGCAGCTGGGCATGTTCACGGAGGGCGAGCTGATGTCGGTG
GGTATGGACACGTTCATCCACCGCATCGACTCCACCGAGGTCATCTACCAGCCGCGCCGC
AAGCGGGCCAAGCTCATCGGCAAGTACCTGATGGGGGACCTGCTGGGGGAAGGCTCTTAC
GGCAAGGTGAAGGAGGTGCTGGACTCGGAGACGCTGTGCAGGAGGGCCGTCAAGATCCTC
AAGAAGAAGAAGTTGCGAAGGATCCCCAACGGGGAGGCCAACGTGAAGAAGGAAATTCAA
CTACTGAGGAGGTTACGGCACAAAAATGTCATCCAGCTGGTGGATGTGTTATACAACGAA
GAGAAGCAGAAAATGTATATGGTGATGGAGTACTGCGTGTGTGGCATGCAGGAAATGCTG
GACAGCGTGCCGGAGAAGCGTTTCCCAGTGTGCCAGGCCCACGGGTACTTCTGTCAGCTG
ATTGACGGCCTGGAGTACCTGCATAGCCAGGGCATTGTGCACAAGGACATCAAGCCGGGG
AACCTGCTGCTCACCACCGGTGGCACCCTCAAAATCTCCGACCTGGGCGTGGCCGAGGCA
CTGCACCCGTTCGCGGCGGACGACACCTGCCGGACCAGCCAGGGCTCCCCGGCTTTCCAG
CCGCCCGAGATTGCCAACGGCCTGGACACCTTCTCCGGCTTCAAGGTGGACATCTGGTCG
GCTGGGGTCACCCTCTACAACATCACCACGGGTCTGTACCCCTTCGAAGGGGACAACATC
TACAAGTTGTTTGAGAACATCGGGAAGGGGAGCTACGCCATCCCGGGCGACTGTGGCCCC
CCGCTCTCTGACCTGCTGAAAGGGATGCTTGAGTACGAACCGGCCAAGAGGTTCTCCATC
CGGCAGATCCGGCAGCACAGCTGGTTCCGGAAGAAACATCCTCCGGCTGAAGCACCAGTG
CCCATCCCACCGAGCCCAGACACCAAGGACCGGTGGCGCAGCATGACTGTGGTGCCGTAC
TTGGAGGACCTGCACGGCGCGGACGAGGACGAGGACCTCTTCGACATCGAGGATGACATC
ATCTACACTCAGGACTTCACGGTGCCCGGACAGGTCCCAGAAGAGGAGGCCAGTCACAAT
GGACAGCGCCGGGGCCTCCCCAAGGCCGTGTGTATGAACGGCACAGAGGCGGCGCAGCTG
AGCACCAAATCCAGGGCGGAGGGCCGGGCCCCCAACCCTGCCCGCAAGGCCTGCTCCGCC
AGCAGCAAGATCCGCCGGCTGTCGGCCTGCAAGCAGCAGTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1761
Start on reference sequence 460
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : STK11
Symbol Nomenclature : STK11
SYNONYM : LKB1; PJS; hLKB1
Designation : liver kinase B1|polarization-related protein LKB1|renal carcinoma antigen NY-REN-19|serine/threonine-protein kinase 11|serine/threonine-protein kinase LKB1|serine/threonine-protein kinase STK11
Full Nomenclature : serine/threonine kinase 11
GENEID : 6794
HGNC : 11389
MIM : 602216
Vega : OTTHUMG00000180118
Target GenBank: BC007981

 

Reference Sequence Alignment

  

HsCD00037961        ATGGAGGTGGTGGACCCGCAGCAGCTGGGCATGTTCACGGAGGGCGAGCTGATGTCGGTG
XM_005259617.1      ATGGAGGTGGTGGACCCGCAGCAGCTGGGCATGTTCACGGAGGGCGAGCTGATGTCGGTG
NM_000455.4         ATGGAGGTGGTGGACCCGCAGCAGCTGGGCATGTTCACGGAGGGCGAGCTGATGTCGGTG
                    ************************************************************

HsCD00037961        GGTATGGACACGTTCATCCACCGCATCGACTCCACCGAGGTCATCTACCAGCCGCGCCGC
XM_005259617.1      GGTATGGACACGTTCATCCACCGCATCGACTCCACCGAGGTCATCTACCAGCCGCGCCGC
NM_000455.4         GGTATGGACACGTTCATCCACCGCATCGACTCCACCGAGGTCATCTACCAGCCGCGCCGC
                    ************************************************************

HsCD00037961        AAGCGGGCCAAGCTCATCGGCAAGTACCTGATGGGGGACCTGCTGGGGGAAGGCTCTTAC
XM_005259617.1      AAGCGGGCCAAGCTCATCGGCAAGTACCTGATGGGGGACCTGCTGGGGGAAGGCTCTTAC
NM_000455.4         AAGCGGGCCAAGCTCATCGGCAAGTACCTGATGGGGGACCTGCTGGGGGAAGGCTCTTAC
                    ************************************************************

HsCD00037961        GGCAAGGTGAAGGAGGTGCTGGACTCGGAGACGCTGTGCAGGAGGGCCGTCAAGATCCTC
XM_005259617.1      GGCAAGGTGAAGGAGGTGCTGGACTCGGAGACGCTGTGCAGGAGGGCCGTCAAGATCCTC
NM_000455.4         GGCAAGGTGAAGGAGGTGCTGGACTCGGAGACGCTGTGCAGGAGGGCCGTCAAGATCCTC
                    ************************************************************

HsCD00037961        AAGAAGAAGAAGTTGCGAAGGATCCCCAACGGGGAGGCCAACGTGAAGAAGGAAATTCAA
XM_005259617.1      AAGAAGAAGAAGTTGCGAAGGATCCCCAACGGGGAGGCCAACGTGAAGAAGGAAATTCAA
NM_000455.4         AAGAAGAAGAAGTTGCGAAGGATCCCCAACGGGGAGGCCAACGTGAAGAAGGAAATTCAA
                    ************************************************************

HsCD00037961        CTACTGAGGAGGTTACGGCACAAAAATGTCATCCAGCTGGTGGATGTGTTATACAACGAA
XM_005259617.1      CTACTGAGGAGGTTACGGCACAAAAATGTCATCCAGCTGGTGGATGTGTTATACAACGAA
NM_000455.4         CTACTGAGGAGGTTACGGCACAAAAATGTCATCCAGCTGGTGGATGTGTTATACAACGAA
                    ************************************************************

HsCD00037961        GAGAAGCAGAAAATGTATATGGTGATGGAGTACTGCGTGTGTGGCATGCAGGAAATGCTG
XM_005259617.1      GAGAAGCAGAAAATGTATATGGTGATGGAGTACTGCGTGTGTGGCATGCAGGAAATGCTG
NM_000455.4         GAGAAGCAGAAAATGTATATGGTGATGGAGTACTGCGTGTGTGGCATGCAGGAAATGCTG
                    ************************************************************

HsCD00037961        GACAGCGTGCCGGAGAAGCGTTTCCCAGTGTGCCAGGCCCACGGGTACTTCTGTCAGCTG
XM_005259617.1      GACAGCGTGCCGGAGAAGCGTTTCCCAGTGTGCCAGGCCCACGGGTACTTCTGTCAGCTG
NM_000455.4         GACAGCGTGCCGGAGAAGCGTTTCCCAGTGTGCCAGGCCCACGGGTACTTCTGTCAGCTG
                    ************************************************************

HsCD00037961        ATTGACGGCCTGGAGTACCTGCATAGCCAGGGCATTGTGCACAAGGACATCAAGCCGGGG
XM_005259617.1      ATTGACGGCCTGGAGTACCTGCATAGCCAGGGCATTGTGCACAAGGACATCAAGCCGGGG
NM_000455.4         ATTGACGGCCTGGAGTACCTGCATAGCCAGGGCATTGTGCACAAGGACATCAAGCCGGGG
                    ************************************************************

HsCD00037961        AACCTGCTGCTCACCACCGGTGGCACCCTCAAAATCTCCGACCTGGGCGTGGCCGAGGCA
XM_005259617.1      AACCTGCTGCTCACCACCGGTGGCACCCTCAAAATCTCCGACCTGGGCGTGGCCGAGGCA
NM_000455.4         AACCTGCTGCTCACCACCGGTGGCACCCTCAAAATCTCCGACCTGGGCGTGGCCGAGGCA
                    ************************************************************

HsCD00037961        CTGCACCCGTTCGCGGCGGACGACACCTGCCGGACCAGCCAGGGCTCCCCGGCTTTCCAG
XM_005259617.1      CTGCACCCGTTCGCGGCGGACGACACCTGCCGGACCAGCCAGGGCTCCCCGGCTTTCCAG
NM_000455.4         CTGCACCCGTTCGCGGCGGACGACACCTGCCGGACCAGCCAGGGCTCCCCGGCTTTCCAG
                    ************************************************************

HsCD00037961        CCGCCCGAGATTGCCAACGGCCTGGACACCTTCTCCGGCTTCAAGGTGGACATCTGGTCG
XM_005259617.1      CCGCCCGAGATTGCCAACGGCCTGGACACCTTCTCCGGCTTCAAGGTGGACATCTGGTCG
NM_000455.4         CCGCCCGAGATTGCCAACGGCCTGGACACCTTCTCCGGCTTCAAGGTGGACATCTGGTCG
                    ************************************************************

HsCD00037961        GCTGGGGTCACCCTCTACAACATCACCACGGGTCTGTACCCCTTCGAAGGGGACAACATC
XM_005259617.1      GCTGGGGTCACCCTCTACAACATCACCACGGGTCTGTACCCCTTCGAAGGGGACAACATC
NM_000455.4         GCTGGGGTCACCCTCTACAACATCACCACGGGTCTGTACCCCTTCGAAGGGGACAACATC
                    ************************************************************

HsCD00037961        TACAAGTTGTTTGAGAACATCGGGAAGGGGAGCTACGCCATCCCGGGCGACTGTGGCCCC
XM_005259617.1      TACAAGTTGTTTGAGAACATCGGGAAGGGGAGCTACGCCATCCCGGGCGACTGTGGCCCC
NM_000455.4         TACAAGTTGTTTGAGAACATCGGGAAGGGGAGCTACGCCATCCCGGGCGACTGTGGCCCC
                    ************************************************************

HsCD00037961        CCGCTCTCTGACCTGCTGAAAGGGATGCTTGAGTACGAACCGGCCAAGAGGTTCTCCATC
XM_005259617.1      CCGCTCTCTGACCTGCTGAAAGGGATGCTTGAGTACGAACCGGCCAAGAGGTTCTCCATC
NM_000455.4         CCGCTCTCTGACCTGCTGAAAGGGATGCTTGAGTACGAACCGGCCAAGAGGTTCTCCATC
                    ************************************************************

HsCD00037961        CGGCAGATCCGGCAGCACAGCTGGTTCCGGAAGAAACATCCTCCGGCTGAAGCACCAGTG
XM_005259617.1      CGGCAGATCCGGCAGCACAGCTGGTTCCGGAAGAAACATCCTCCGGCTGAAGCACCAGTG
NM_000455.4         CGGCAGATCCGGCAGCACAGCTGGTTCCGGAAGAAACATCCTCCGGCTGAAGCACCAGTG
                    ************************************************************

HsCD00037961        CCCATCCCACCGAGCCCAGACACCAAGGACCGGTGGCGCAGCATGACTGTGGTGCCGTAC
XM_005259617.1      CCCATCCCACCGAGCCCAGACACCAAGGACCGGTGGCGCAGCATGACTGTGGTGCCGTAC
NM_000455.4         CCCATCCCACCGAGCCCAGACACCAAGGACCGGTGGCGCAGCATGACTGTGGTGCCGTAC
                    ************************************************************

HsCD00037961        TTGGAGGACCTGCACGGCGCGGACGAGGACGAGGACCTCTTCGACATCGAGGATGACATC
XM_005259617.1      TTGGAGGACCTGCACGGCGCGGACGAGGACGAGGACCTCTTCGACATCGAGGATGACATC
NM_000455.4         TTGGAGGACCTGCACGGCGCGGACGAGGACGAGGACCTCTTCGACATCGAGGATGACATC
                    ************************************************************

HsCD00037961        ATCTACACTCAGGACTTCACGGTGCCCGGACAGGTCCCAGAAGAGGAGGCCAGTCACAAT
XM_005259617.1      ATCTACACTCAGGACTTCACGGTGCCCG-----GTCCCAGAAGAGGAGGCCAGTCACAAT
NM_000455.4         ATCTACACTCAGGACTTCACGGTGCCCGGACAGGTCCCAGAAGAGGAGGCCAGTCACAAT
                    ****************************     ***************************

HsCD00037961        GGACAGCGCCGGGGCCTCCCCAAGGCCGTGTGTATGAACGGCACAGAGGCGGCGCAGCTG
XM_005259617.1      GGACAGCGCCGGGGCCTCCCCAAGGCCGTGTGTATGAACGGCACAGAGGCGGCGCAGCTG
NM_000455.4         GGACAGCGCCGGGGCCTCCCCAAGGCCGTGTGTATGAACGGCACAGAGGCGGCGCAGCTG
                    ************************************************************

HsCD00037961        AGCACCAAATCCAGGGCGGAGGGCCGGGCCCCCAACCCTGCCCGCAAGGCCTGCTCCGCC
XM_005259617.1      AGCACCAAATCCAGGGCGGAGGGCCGGGCCCCCAACCCTGCCCGCAAGGCCTGCTCCGCC
NM_000455.4         AGCACCAAATCCAGGGCGGAGGGCCGGGCCCCCAACCCTGCCCGCAAGGCCTGCTCCGCC
                    ************************************************************

HsCD00037961        AGCAGCAAGATCCGCCGGCTGTCGGCCTGCAAGCAGCAGTTG------------------
XM_005259617.1      AGCAGCAAGATCCGCCGGCTGTCGGCCTGCAAGCAGCAGTGAGGCTGGCCGCCTGCAGCC
NM_000455.4         AGCAGCAAGATCCGCCGGCTGTCGGCCTGCAAGCAGCAGTGA------------------
                    **************************************** .                  

HsCD00037961        ------------------------------------------------------------
XM_005259617.1      CGTGTCCAGGAGCCCCGCCAGGTGCCCGCGCCAGGCCCTCAGTCTTCCTGCCGGTTCCGC
NM_000455.4         ------------------------------------------------------------
                                                                                

HsCD00037961        ------------------------------------------------------------
XM_005259617.1      CCGCCCTCCCGGAGAGGTGGCCGCCATGCTTCTGTGCCGACCACGCCCCAGGACCTCCGG
NM_000455.4         ------------------------------------------------------------
                                                                                

HsCD00037961        ------------------------------------------------------------
XM_005259617.1      AGCGCCCTGCAGGGCCGGGCAGGGGGACAGCAGGGACCGGGCGCAGCCCTCCCCCCTCGG
NM_000455.4         ------------------------------------------------------------
                                                                                

HsCD00037961        ------------------------------------------------------------
XM_005259617.1      CCGCCCGGCAGTGCACGCGGCTTGTTGACTTCGCAGCCCCGGGCGGAGCCTTCCCGGGCG
NM_000455.4         ------------------------------------------------------------
                                                                                

HsCD00037961        ------------------------------------------------------------
XM_005259617.1      GGCGTGGGAGGAGGGAGGCGGCCTCCATGCACTTTATGTGGAGACTACTGGCCCCGCCCG
NM_000455.4         ------------------------------------------------------------
                                                                                

HsCD00037961        ------------------------------------------------------------
XM_005259617.1      TGGCCTCGTGCTCCGCAGGGCGCCCAGCGCCGTCCGGCGGCCCCGCCGCAGACCAGCTGG
NM_000455.4         ------------------------------------------------------------
                                                                                

HsCD00037961        ------------------------------------------------------------
XM_005259617.1      CGGGTGTGGAGACCAGGCTCCTGACCCCGCCATGCATGCAGCGCCACCTGGAAGCCGCGC
NM_000455.4         ------------------------------------------------------------
                                                                                

HsCD00037961        ------------------------------------------------------------
XM_005259617.1      GGCCGCTTTGGTTTTTTGTTTGGTTGGTTCCATTTTCTTTTTTTCTTTTTTTTTTTAAGA
NM_000455.4         ------------------------------------------------------------
                                                                                

HsCD00037961        --------
XM_005259617.1      AAAAATAA
NM_000455.4         --------
                            

Pathways

NCI : LKB1 signaling events
Panther : p53 pathway by glucose deprivation
Reactome : AMPK inhibits chREBP transcriptional activation activity
Reactome : Energy dependent regulation of mTOR by LKB1-AMPK
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Insulin receptor signalling cascade
Reactome : Integration of energy metabolism
Reactome : Metabolism
Reactome : PI3K Cascade
Reactome : PKB-mediated events
Reactome : Regulation of AMPK activity via LKB1
Reactome : Signal Transduction
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : mTOR signalling
WikiPathway : AMPK signaling
WikiPathway : Integrated Breast Cancer Pathway

Clone

Cloning Information : 138524
HIP Master Clone ID : 87188
Original Clone ID : FLH138524.01L

Organism


TAX_ID : 9606
Species Specific ID: 6794

Genome

Chromosome : 19
Map Location : 19p13.3
Ensembl : ENSG00000118046

Reagents

Labome : LKB1-antibody