DNASU Plasmid Repository • 480.965.5697 | Email

CDK2 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDK2
Gene Name:  cyclin-dependent kinase 2
Sequence             
Original Clone ID: FLH138527.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00037964

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 897nts         Open reading frame : 1 to 897

ATGGAGAACTTCCAAAAGGTGGAAAAGATCGGAGAGGGCACGTACGGAGTTGTGTACAAA
GCCAGAAACAAGTTGACGGGAGAGGTGGTGGCGCTTAAGAAAATCCGCCTGGACACTGAG
ACTGAGGGTGTGCCCAGTACTGCCATCCGAGAGATCTCTCTGCTTAAGGAGCTTAACCAT
CCTAATATTGTCAAGCTGCTGGATGTCATTCACACAGAAAATAAACTCTACCTGGTTTTT
GAATTTCTGCACCAAGATCTCAAGAAATTCATGGATGCCTCTGCTCTCACTGGCATTCCT
CTTCCCCTCATCAAGAGCTATCTGTTCCAGCTGCTCCAGGGCCTAGCTTTCTGCCATTCT
CATCGGGTCCTCCACCGAGACCTTAAACCTCAGAATCTGCTTATTAACACAGAGGGGGCC
ATCAAGCTAGCAGACTTTGGACTAGCCAGAGCTTTTGGAGTCCCTGTTCGTACTTACACC
CATGAGGTGGTGACCCTGTGGTACCGAGCTCCTGAAATCCTCCTGGGCTGCAAATATTAT
TCCACAGCTGTGGACATCTGGAGCCTGGGCTGCATCTTTGCTGAGATGGTGACTCGCCGG
GCCCTATTCCCTGGAGATTCTGAGATTGACCAGCTCTTCCGGATCTTTCGGACTCTGGGG
ACCCCAGATGAGGTGGTGTGGCCAGGAGTTACTTCTATGCCTGATTACAAGCCAAGTTTC
CCCAAGTGGGCCCGGCAAGATTTTAGTAAAGTTGTACCTCCCCTGGATGAAGATGGACGG
AGCTTGTTATCGCAAATGCTGCACTACGACCCTAACAAGCGGATTTCGGCCAAGGCAGCC
CTGGCTCACCCTTTCTTCCAGGATGTGACCAAGCCAGTACCCCATCTTCGACTCTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1066
Start on reference sequence 170
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDK2
Symbol Nomenclature : CDK2
SYNONYM : p33(CDK2)
Designation : cdc2-related protein kinase|cell devision kinase 2|cell division protein kinase 2|p33 protein kinase
Full Nomenclature : cyclin-dependent kinase 2
GENEID : 1017
HGNC : 1771
MIM : 116953
Vega : OTTHUMG00000170575
Target GenBank: BC003065

 

Pathways

NCI : ATR signaling pathway
NCI : BARD1 signaling events
NCI : E2F transcription factor network
NCI : FOXM1 transcription factor network
NCI : FoxO family signaling
NCI : IL2-mediated signaling events
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Regulation of retinoblastoma protein
NCI : Signaling events mediated by PRL
NCI : mTOR signaling pathway
NCI : p53 pathway
NCI : p73 transcription factor network
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : Activation of ATR in response to replication stress
Reactome : Activation of the pre-replicative complex
Reactome : CDK-mediated phosphorylation and removal of Cdc6
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Cyclin A/B1 associated events during G2/M transition
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin E associated events during G1/S transition
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : G0 and Early G1
Reactome : G1/S DNA Damage Checkpoints
Reactome : G1/S Transition
Reactome : G2 Phase
Reactome : G2/M Checkpoints
Reactome : G2/M Transition
Reactome : Hemostasis
Reactome : M/G1 Transition
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : Mitotic M-M/G1 phases
Reactome : Orc1 removal from chromatin
Reactome : Phosphorylation of proteins involved in G1/S transition by active Cyclin E:Cdk2 complexes
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of DNA replication
Reactome : Regulation of mitotic cell cycle
Reactome : Removal of licensing factors from origins
Reactome : S Phase
Reactome : SCF(Skp2)-mediated degradation of p27/p21
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Switching of origins to a post-replicative state
Reactome : Synthesis of DNA
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA Replication
WikiPathway : DNA damage response
WikiPathway : G1 to S cell cycle control
WikiPathway : ID signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : TSH signaling pathway
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 138527
HIP Master Clone ID : 87191
Original Clone ID : FLH138527.01L

Organism


TAX_ID : 9606
Species Specific ID: 1017

Genome

Chromosome : 12
Map Location : 12q13
Ensembl : ENSG00000123374

Reagents

Labome : CDK2-antibody