DNASU Plasmid Repository • 480.965.5697 | Email

RFK (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RFK
Gene Name:  riboflavin kinase
Sequence             
Original Clone ID: FLH138528.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00037965

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 489nts         Open reading frame : 1 to 489
Reference Sequence Alignment

ATGCCCCGAGCGGACTGCATTATGAGGCACCTGCCTTACTTCTGCCGGGGTCAAGTGGTG
CGGGGCTTCGGCCGCGGCTCCAAGCAGCTGGGCATCCCCACAGCTAATTTTCCTGAGCAA
GTGGTAGATAATCTTCCAGCTGATATATCCACTGGTATTTACTATGGTTGGGCCAGTGTT
GGAAGTGGAGATGTCCATAAGATGGTGGTGAGCATAGGATGGAACCCATATTACAAGAAT
ACGAAGAAGTCTATGGAAACACATATCATGCATACCTTCAAAGAGGACTTCTATGGGGAA
ATCCTCAATGTGGCCATTGTTGGCTACCTGAGACCAGAAAAGAACTTTGATTCTTTAGAG
TCACTTATTTCAGCAATTCAAGGTGATATTGAAGAAGCTAAGAAACGACTAGAGTTACCA
GAACATTTGAAAATCAAAGAAGACAATTTCTTCCAGGTTTCTAAAAGCAAAATAATGAAT
GGCCACTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 647
Start on reference sequence 159
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RFK
Symbol Nomenclature : RFK
SYNONYM : RIFK
Designation : 0610038L10Rik|ATP:riboflavin 5'-phosphotransferase|flavokinase
Full Nomenclature : riboflavin kinase
GENEID : 55312
Locus Tag : RP11-422N19.2
HGNC : 30324
MIM : 613010
Vega : OTTHUMG00000020040
Target GenBank: BC015473

 

Reference Sequence Alignment

  

HsCD00037965      ATGCCCCGAGCGGACTGCATTATGAGGCACCTGCCTTACTTCTGCCGGGGTCAAGTGGTG
NM_018339.5       ---------------------ATGAGGCACCTGCCTTACTTCTGCCGGGGTCAAGTGGTG
                                       ***************************************

HsCD00037965      CGGGGCTTCGGCCGCGGCTCCAAGCAGCTGGGCATCCCCACAGCTAATTTTCCTGAGCAA
NM_018339.5       CGGGGCTTCGGCCGCGGCTCCAAGCAGCTGGGCATCCCCACAGCTAATTTTCCTGAGCAA
                  ************************************************************

HsCD00037965      GTGGTAGATAATCTTCCAGCTGATATATCCACTGGTATTTACTATGGTTGGGCCAGTGTT
NM_018339.5       GTGGTAGATAATCTTCCAGCTGATATATCCACTGGTATTTACTATGGTTGGGCCAGTGTT
                  ************************************************************

HsCD00037965      GGAAGTGGAGATGTCCATAAGATGGTGGTGAGCATAGGATGGAACCCATATTACAAGAAT
NM_018339.5       GGAAGTGGAGATGTCCATAAGATGGTGGTGAGCATAGGATGGAACCCATATTACAAGAAT
                  ************************************************************

HsCD00037965      ACGAAGAAGTCTATGGAAACACATATCATGCATACCTTCAAAGAGGACTTCTATGGGGAA
NM_018339.5       ACGAAGAAGTCTATGGAAACACATATCATGCATACCTTCAAAGAGGACTTCTATGGGGAA
                  ************************************************************

HsCD00037965      ATCCTCAATGTGGCCATTGTTGGCTACCTGAGACCAGAAAAGAACTTTGATTCTTTAGAG
NM_018339.5       ATCCTCAATGTGGCCATTGTTGGCTACCTGAGACCAGAAAAGAACTTTGATTCTTTAGAG
                  ************************************************************

HsCD00037965      TCACTTATTTCAGCAATTCAAGGTGATATTGAAGAAGCTAAGAAACGACTAGAGTTACCA
NM_018339.5       TCACTTATTTCAGCAATTCAAGGTGATATTGAAGAAGCTAAGAAACGACTAGAGTTACCA
                  ************************************************************

HsCD00037965      GAACATTTGAAAATCAAAGAAGACAATTTCTTCCAGGTTTCTAAAAGCAAAATAATGAAT
NM_018339.5       GAACATTTGAAAATCAAAGAAGACAATTTCTTCCAGGTTTCTAAAAGCAAAATAATGAAT
                  ************************************************************

HsCD00037965      GGCCACTTG
NM_018339.5       GGCCACTGA
                  ******* .

Pathways

Panther : Flavin biosynthesis
Reactome : Defective AMN causes hereditary megaloblastic anemia 1
Reactome : Defective BTD causes biotidinase deficiency
Reactome : Defective CD320 causes methylmalonic aciduria
Reactome : Defective CUBN causes hereditary megaloblastic anemia 1
Reactome : Defective GIF causes intrinsic factor deficiency
Reactome : Defective HLCS causes multiple carboxylase deficiency
Reactome : Defective LMBRD1 causes methylmalonic aciduria and homocystinuria type cblF
Reactome : Defective MMAA causes methylmalonic aciduria type cblA
Reactome : Defective MMAB causes methylmalonic aciduria type cblB
Reactome : Defective MMACHC causes methylmalonic aciduria and homocystinuria type cblC
Reactome : Defective MMADHC causes methylmalonic aciduria and homocystinuria type cblD
Reactome : Defective MTR causes methylmalonic aciduria and homocystinuria type cblG
Reactome : Defective MTRR causes methylmalonic aciduria and homocystinuria type cblE
Reactome : Defective MUT causes methylmalonic aciduria mut type
Reactome : Defective TCN2 causes hereditary megaloblastic anemia
Reactome : Defects in biotin (Btn) metabolism
Reactome : Defects in cobalamin (B12) metabolism
Reactome : Defects in vitamin and cofactor metabolism
Reactome : Disease
Reactome : Metabolism
Reactome : Metabolism of vitamins and cofactors
Reactome : Metabolism of water-soluble vitamins and cofactors
Reactome : Vitamin B2 (riboflavin) metabolism
WikiPathway : Folate Metabolism
WikiPathway : Selenium Pathway
WikiPathway : TNF alpha Signaling Pathway

Protein

SMART domain : Flavokinase : Riboflavin kinase
UniProt : Q969G6
UniProt : B2RDZ2
HPRD : 17969

Clone

Cloning Information : 138528
HIP Master Clone ID : 87192
Original Clone ID : FLH138528.01L

Organism


TAX_ID : 9606
Species Specific ID: 55312

Genome

Chromosome : 9
Map Location : 9q21.13
Ensembl : ENSG00000135002

Reagents

Labome : RFK-antibody