DNASU Plasmid Repository • 480.965.5697 | Email

CSNK2A2 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CSNK2A2
Gene Name:  casein kinase 2, alpha prime polypeptide
Sequence             
Original Clone ID: FLH138529.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00037966

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1053nts         Open reading frame : 1 to 1053
Reference Sequence Alignment

ATGCCCGGCCCGGCCGCGGGCAGCAGGGCCCGGGTCTACGCCGAGGTGAACAGTCTGAGG
AGCCGCGAGTACTGGGACTACGAGGCTCACGTCCCGAGCTGGGGTAATCAAGATGATTAC
CAACTGGTTCGAAAACTTGGTCGGGGAAAATATAGTGAAGTATTTGAGGCCATTAATATC
ACCAACAATGAGAGAGTGGTTGTAAAAATCCTGAAGCCAGTGAAGAAAAAGAAGATAAAA
CGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
CTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATGTGAAACCT
CACAATGTCATGATAGATCACCAACAGAAAAAGCTGCGACTGATAGATTGGGGTCTGGCA
GAATTCTATCATCCTGCTCAGGAGTACAATGTTCGTGTAGCCTCAAGGTACTTCAAGGGA
CCAGAGCTCCTCGTGGACTATCAGATGTATGATTATAGCTTGGACATGTGGAGTTTGGGC
TGTATGTTAGCAAGCATGATCTTTCGAAGGGAACCATTCTTCCATGGACAGGACAACTAT
GACCAGCTTGTTCGCATTGCCAAGGTTCTGGGTACAGAAGAACTGTATGGGTATCTGAAG
AAGTATCACATAGACCTAGATCCACACTTCAACGATATCCTGGGACAACATTCACGGAAA
CGCTGGGAAAACTTTATCCATAGTGAGAACAGACACCTTGTCAGCCCTGAGGCCCTAGAT
CTTCTGGACAAACTTCTGCGATACGACCATCAACAGAGACTGACTGCCAAAGAGGCCATG
GAGCACCCATACTTCTACCCTGTGGTGAAGGAGCAGTCCCAGCCTTGTGCAGACAATGCT
GTGCTTTCCAGTGGTCTCACGGCAGCACGATTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1216
Start on reference sequence 164
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CSNK2A2
Symbol Nomenclature : CSNK2A2
SYNONYM : CK2A2; CSNK2A1
Designation : CK II alpha'|casein kinase II subunit alpha'
Full Nomenclature : casein kinase 2, alpha prime polypeptide
GENEID : 1459
HGNC : 2459
MIM : 115442
Vega : OTTHUMG00000133488
Target GenBank: NM_001896

 

Reference Sequence Alignment

  

HsCD00037966        ATGCCCGGCCCGGCCGCGGGCAGCAGGGCCCGGGTCTACGCCGAGGTGAACAGTCTGAGG
NM_001896.2         ATGCCCGGCCCGGCCGCGGGCAGCAGGGCCCGGGTCTACGCCGAGGTGAACAGTCTGAGG
XM_005255799.1      ATGCCCGGCCCGGCCGCGGGCAGCAGGGCCCGGGTCTACGCCGAGGTGAACAGTCTGAGG
                    ************************************************************

HsCD00037966        AGCCGCGAGTACTGGGACTACGAGGCTCACGTCCCGAGCTGGGGTAATCAAGATGATTAC
NM_001896.2         AGCCGCGAGTACTGGGACTACGAGGCTCACGTCCCGAGCTGGGGTAATCAAGATGATTAC
XM_005255799.1      AGCCGCGAGTACTGGGACTACGAGGCTCACGTCCCGAGCTGGGGTAATCAAGATGATTAC
                    ************************************************************

HsCD00037966        CAACTGGTTCGAAAACTTGGTCGGGGAAAATATAGTGAAGTATTTGAGGCCATTAATATC
NM_001896.2         CAACTGGTTCGAAAACTTGGTCGGGGAAAATATAGTGAAGTATTTGAGGCCATTAATATC
XM_005255799.1      CAACTGGTTCGAAAACTTGGTCGGGGAAAATATAGTGAAGTATTTGAGGCCATTAATATC
                    ************************************************************

HsCD00037966        ACCAACAATGAGAGAGTGGTTGTAAAAATCCTGAAGCCAGTGAAGAAAAAGAAGATAAAA
NM_001896.2         ACCAACAATGAGAGAGTGGTTGTAAAAATCCTGAAGCCAGTGAAGAAAAAGAAGATAAAA
XM_005255799.1      ACCAACAATGAGAGAGTGGTTGTAAAAATCCTGAAGCCAGTGAAGAAAAAGAAGATAAAA
                    ************************************************************

HsCD00037966        CGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
NM_001896.2         CGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
XM_005255799.1      CGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
                    ************************************************************

HsCD00037966        ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
NM_001896.2         ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
XM_005255799.1      ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
                    ************************************************************

HsCD00037966        GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
NM_001896.2         GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
XM_005255799.1      GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
                    ************************************************************

HsCD00037966        CTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATGTGAAACCT
NM_001896.2         CTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATGTGAAACCT
XM_005255799.1      CTACTTAAACTGCG----------------------------------------------
                    *********   *                                               

HsCD00037966        CACAATGTCATGATAGATCACCAACAGAAAAAGCTGCGACTGATAGATTGGGGTCTGGCA
NM_001896.2         CACAATGTCATGATAGATCACCAACAGAAAAAGCTGCGACTGATAGATTGGGGTCTGGCA
XM_005255799.1      --------------------------------------ACTGATAGATTGGGGTCTGGCA
                                                          **********************

HsCD00037966        GAATTCTATCATCCTGCTCAGGAGTACAATGTTCGTGTAGCCTCAAGGTACTTCAAGGGA
NM_001896.2         GAATTCTATCATCCTGCTCAGGAGTACAATGTTCGTGTAGCCTCAAGGTACTTCAAGGGA
XM_005255799.1      GAATTCTATCATCCTGCTCAGGAGTACAATGTTCGTGTAGCCTCAAGGTACTTCAAGGGA
                    ************************************************************

HsCD00037966        CCAGAGCTCCTCGTGGACTATCAGATGTATGATTATAGCTTGGACATGTGGAGTTTGGGC
NM_001896.2         CCAGAGCTCCTCGTGGACTATCAGATGTATGATTATAGCTTGGACATGTGGAGTTTGGGC
XM_005255799.1      CCAGAGCTCCTCGTGGACTATCAGATGTATGATTATAGCTTGGACATGTGGAGTTTGGGC
                    ************************************************************

HsCD00037966        TGTATGTTAGCAAGCATGATCTTTCGAAGGGAACCATTCTTCCATGGACAGGACAACTAT
NM_001896.2         TGTATGTTAGCAAGCATGATCTTTCGAAGGGAACCATTCTTCCATGGACAGGACAACTAT
XM_005255799.1      TGTATGTTAGCAAGCATGATCTTTCGAAGGGAACCATTCTTCCATGGACAGGACAACTAT
                    ************************************************************

HsCD00037966        GACCAGCTTGTTCGCATTGCCAAGGTTCTGGGTACAGAAGAACTGTATGGGTATCTGAAG
NM_001896.2         GACCAGCTTGTTCGCATTGCCAAGGTTCTGGGTACAGAAGAACTGTATGGGTATCTGAAG
XM_005255799.1      GACCAGCTTGTTCGCATTGCCAAGGTTCTGGGTACAGAAGAACTGTATGGGTATCTGAAG
                    ************************************************************

HsCD00037966        AAGTATCACATAGACCTAGATCCACACTTCAACGATATCCTGGGACAACATTCACGGAAA
NM_001896.2         AAGTATCACATAGACCTAGATCCACACTTCAACGATATCCTGGGACAACATTCACGGAAA
XM_005255799.1      AAGTATCACATAGACCTAGATCCACACTTCAACGATATCCTGGGACAACATTCACGGAAA
                    ************************************************************

HsCD00037966        CGCTGGGAAAACTTTATCCATAGTGAGAACAGACACCTTGTCAGCCCTGAGGCCCTAGAT
NM_001896.2         CGCTGGGAAAACTTTATCCATAGTGAGAACAGACACCTTGTCAGCCCTGAGGCCCTAGAT
XM_005255799.1      CGCTGGGAAAACTTTATCCATAGTGAGAACAGACACCTTGTCAGCCCTGAGGCCCTAGAT
                    ************************************************************

HsCD00037966        CTTCTGGACAAACTTCTGCGATACGACCATCAACAGAGACTGACTGCCAAAGAGGCCATG
NM_001896.2         CTTCTGGACAAACTTCTGCGATACGACCATCAACAGAGACTGACTGCCAAAGAGGCCATG
XM_005255799.1      CTTCTGGACAAACTTCTGCGATACGACCATCAACAGAGACTGACTGCCAAAGAGGCCATG
                    ************************************************************

HsCD00037966        GAGCACCCATACTTCTACCCTGTGGTGAAGGAGCAGTCCCAGCCTTGTGCAGACAATGCT
NM_001896.2         GAGCACCCATACTTCTACCCTGTGGTGAAGGAGCAGTCCCAGCCTTGTGCAGACAATGCT
XM_005255799.1      GAGCACCCATACTTCTACCCTGTGGTGAAGGAGCAGTCCCAGCCTTGTGCAGACAATGCT
                    ************************************************************

HsCD00037966        GTGCTTTCCAGTGGTCTCACGGCAGCACGATTG
NM_001896.2         GTGCTTTCCAGTGGTCTCACGGCAGCACGATGA
XM_005255799.1      GTGCTTTCCAGTGGTCTCACGGCAGCACGATGA
                    ******************************* .

Pathways

NCI : Atypical NF-kappaB pathway
NCI : DNA-PK pathway in nonhomologous end joining
NCI : E-cadherin signaling in the nascent adherens junction
NCI : Signaling mediated by p38-alpha and p38-beta
Panther : Cadherin signaling pathway
Panther : Parkinson disease
Panther : Wnt signaling pathway
Reactome : Axon guidance
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Condensation of Prometaphase Chromosomes
Reactome : Developmental Biology
Reactome : L1CAM interactions
Reactome : M Phase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prometaphase
Reactome : Signal Transduction
Reactome : Signal transduction by L1
Reactome : Signaling by Wnt
Reactome : TCF dependent signaling in response to WNT
Reactome : WNT mediated activation of DVL

Clone

Cloning Information : 138529
HIP Master Clone ID : 87193
Original Clone ID : FLH138529.01L

Organism


TAX_ID : 9606
Species Specific ID: 1459

Genome

Chromosome : 16
Map Location : 16q21
Ensembl : ENSG00000070770

Reagents

Labome : CSNK2A2-antibody