DNASU Plasmid Repository • 480.965.5697 | Email

MAPK7 (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  MAPK7
Gene Name:  mitogen-activated protein kinase 7
Original Clone ID: FLH138530.01L
Keyword: short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Discrepancy :
No / Yes
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 2034nts         Open reading frame : 1 to 2034
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 2411
Start on reference sequence 378

5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : MAPK7
Symbol Nomenclature : MAPK7
Designation : BMK-1|BMK1 kinase|ERK-5|MAP kinase 7|MAPK 7|big MAP kinase 1|extracellular signal-regulated kinase 5|extracellular-signal-regulated kinase 5
Full Nomenclature : mitogen-activated protein kinase 7
GENEID : 5598
HGNC : 6880
MIM : 602521
Vega : OTTHUMG00000059587
Target GenBank: BC007992


Reference Sequence Alignment


HsCD00037967        ------------------------------------------------------------
NM_139032.2         ------------------------------------------------------------
XM_005256719.1      ------------------------------------------------------------

HsCD00037967        ------------------------------------------------------------
NM_139032.2         ------------------------------------------------------------
XM_005256719.1      ------------------------------------------------------------

HsCD00037967        ------------------------------------------------------------
NM_139032.2         ------------------------------------------------------------
XM_005256719.1      ------------------------------------------------------------

HsCD00037967        ------------------------------------------------------------
NM_139032.2         ------------------------------------------------------------
XM_005256719.1      ------------------------------------------------------------

HsCD00037967        ------------------------------------------------------------
NM_139032.2         ------------------------------------------------------------
XM_005256719.1      ------------------------------------------------------------

HsCD00037967        ------------------------------------------------------------
NM_139032.2         ------------------------------------------------------------
XM_005256719.1      ------------------------------------------------------------

HsCD00037967        ---------------------------------------------------------ATG
NM_139032.2         ---------------------------------------------------------ATG
XM_005256719.1      ---------------------------------------------------------ATG


































                    ************************************************* .


NCI : ErbB1 downstream signaling
NCI : Trk receptor signaling mediated by the MAPK pathway
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : Parkinson disease
Reactome : Activated TLR4 signalling
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : ERK/MAPK targets
Reactome : ERKs are inactivated
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signalling by NGF
Reactome : Signalling to ERK5
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Focal Adhesion
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Lymphocyte TarBase
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Muscle cell TarBase
WikiPathway : Signal Transduction of S1P Receptor


Cloning Information : 138530
HIP Master Clone ID : 87194
Original Clone ID : FLH138530.01L


TAX_ID : 9606
Species Specific ID: 5598


Chromosome : 17
Map Location : 17p11.2
Ensembl : ENSG00000166484


Labome : ERK5-antibody