DNASU Plasmid Repository • 480.965.5697 | Email

PRKCI (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRKCI
Gene Name:  protein kinase C, iota
Sequence             
Original Clone ID: FLH138533.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00037968

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1764nts         Open reading frame : 1 to 1764
Reference Sequence Alignment

ATGTCCCACACGGTCGCAGGCGGCGGCAGCGGGGACCATTCCCACCAGGTCCGGGTGAAA
GCCTACTACCGCGGGGATATCATGATAACACATTTTGAACCTTCCATCTCCTTTGAGGGC
CTTTGCAATGAGGTTCGAGACATGTGTTCTTTTGACAACGAACAGCTCTTCACCATGAAA
TGGATAGATGAGGAAGGAGACCCGTGTACAGTATCATCTCAGTTGGAGTTAGAAGAAGCC
TTTAGACTTTATGAGCTAAACAAGGATTCTGAACTCTTGATTCATGTGTTCCCTTGTGTA
CCAGAACGTCCTGGGATGCCTTGTCCAGGAGAAGATAAATCCATCTACCGTAGAGGTGCA
CGCCGCTGGAGAAAGCTTTATTGTGCCAATGGCCACACTTTCCAAGCCAAGCGTTTCAAC
AGGCGTGCTCACTGTGCCATCTGCACAGACCGAATATGGGGACTTGGACGCCAAGGATAT
AAGTGCATCAACTGCAAACTCTTGGTTCATAAGAAGTGCCATAAACTCGTCACAATTGAA
TGTGGGCGGCATTCTTTGCCACAGGAACCAGTGATGCCCATGGATCAGTCATCCATGCAT
TCTGACCATGCACAGACAGTAATTCCATATAATCCTTCAAGTCATGAGAGTTTGGATCAA
GTTGGTGAAGAAAAAGAGGCAATGAACACCAGGGAAAGTGGCAAAGCTTCATCCAGTCTA
GGTCTTCAGGATTTTGATTTGCTCCGGGTAATAGGAAGAGGAAGTTATGCCAAAGTACTG
TTGGTTCGATTAAAAAAAACAGATCGTATTTATGCAATGAAAGTTGTGAAAAAAGAGCTT
GTTAATGATGATGAGGATATTGATTGGGTACAGACAGAGAAGCATGTGTTTGAGCAGGCA
TCCAATCATCCTTTCCTTGTTGGGCTGCATTCTTGCTTTCAGACAGAAAGCAGATTGTTC
TTTGTTATAGAGTATGTAAATGGAGGAGACCTAATGTTTCATATGCAGCGACAAAGAAAA
CTTCCTGAAGAACATGCCAGATTTTACTCTGCAGAAATCAGTCTAGCATTAAATTATCTT
CATGAGCGAGGGATAATTTATAGAGATTTGAAACTGGACAATGTATTACTGGACTCTGAA
GGCCACATTAAACTCACTGACTACGGCATGTGTAAGGAAGGATTACGGCCAGGAGATACA
ACCAGCACTTTCTGTGGTACTCCTAATTACATTGCTCCTGAAATTTTAAGAGGAGAAGAT
TATGGTTTCAGTGTTGACTGGTGGGCTCTTGGAGTGCTCATGTTTGAGATGATGGCAGGA
AGGTCTCCATTTGATATTGTTGGGAGCTCCGATAACCCTGACCAGAACACAGAGGATTAT
CTCTTCCAAGTTATTTTGGAAAAACAAATTCGCATACCACGTTCTCTGTCTGTAAAAGCT
GCGAGTGTTCTGAAGAGTTTTCTTAATAAGGACCCTAAGGAACGATTGGGTTGTCATCCT
CAAACAGGATTTGCTGATATTCAGGGACACCCGTTCTTCCGAAATGTTGATTGGGATATG
ATGGAGCAAAAACAGGTGGTACCTCCCTTTAAACCAAATATTTCTGGGGAATTTGGTTTG
GACAACTTTGATTCTCAGTTTACTAATGAACCTGTCCAGCTCACTCCAGATGACGATGAC
ATTGTGAGGAAGATTGATCAGTCTGAATTTGAAGGTTTTGAGTATATCAATCCTCTTTTG
ATGTCTGCAGAAGAATGTGTCTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1968
Start on reference sequence 205
Mutations:
None
Discrepancy:
a1443g
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRKCI
Symbol Nomenclature : PRKCI
SYNONYM : DXS1179E; PKCI; nPKC-iota
Designation : PRKC-lambda/iota|aPKC-lambda/iota|atypical protein kinase C-lambda/iota|protein kinase C iota type
Full Nomenclature : protein kinase C, iota
GENEID : 5584
HGNC : 9404
MIM : 600539
Vega : OTTHUMG00000150214
Target GenBank: NM_002740

 

Reference Sequence Alignment

  

HsCD00037968      ---------------------------ATGTCCCACACGGTCGCAGGCGGCGGCAGCGGG
NM_002740.5       ATGCCGACCCAGAGGGACAGCAGCACCATGTCCCACACGGTCGCAGGCGGCGGCAGCGGG
                                             *********************************

HsCD00037968      GACCATTCCCACCAGGTCCGGGTGAAAGCCTACTACCGCGGGGATATCATGATAACACAT
NM_002740.5       GACCATTCCCACCAGGTCCGGGTGAAAGCCTACTACCGCGGGGATATCATGATAACACAT
                  ************************************************************

HsCD00037968      TTTGAACCTTCCATCTCCTTTGAGGGCCTTTGCAATGAGGTTCGAGACATGTGTTCTTTT
NM_002740.5       TTTGAACCTTCCATCTCCTTTGAGGGCCTTTGCAATGAGGTTCGAGACATGTGTTCTTTT
                  ************************************************************

HsCD00037968      GACAACGAACAGCTCTTCACCATGAAATGGATAGATGAGGAAGGAGACCCGTGTACAGTA
NM_002740.5       GACAACGAACAGCTCTTCACCATGAAATGGATAGATGAGGAAGGAGACCCGTGTACAGTA
                  ************************************************************

HsCD00037968      TCATCTCAGTTGGAGTTAGAAGAAGCCTTTAGACTTTATGAGCTAAACAAGGATTCTGAA
NM_002740.5       TCATCTCAGTTGGAGTTAGAAGAAGCCTTTAGACTTTATGAGCTAAACAAGGATTCTGAA
                  ************************************************************

HsCD00037968      CTCTTGATTCATGTGTTCCCTTGTGTACCAGAACGTCCTGGGATGCCTTGTCCAGGAGAA
NM_002740.5       CTCTTGATTCATGTGTTCCCTTGTGTACCAGAACGTCCTGGGATGCCTTGTCCAGGAGAA
                  ************************************************************

HsCD00037968      GATAAATCCATCTACCGTAGAGGTGCACGCCGCTGGAGAAAGCTTTATTGTGCCAATGGC
NM_002740.5       GATAAATCCATCTACCGTAGAGGTGCACGCCGCTGGAGAAAGCTTTATTGTGCCAATGGC
                  ************************************************************

HsCD00037968      CACACTTTCCAAGCCAAGCGTTTCAACAGGCGTGCTCACTGTGCCATCTGCACAGACCGA
NM_002740.5       CACACTTTCCAAGCCAAGCGTTTCAACAGGCGTGCTCACTGTGCCATCTGCACAGACCGA
                  ************************************************************

HsCD00037968      ATATGGGGACTTGGACGCCAAGGATATAAGTGCATCAACTGCAAACTCTTGGTTCATAAG
NM_002740.5       ATATGGGGACTTGGACGCCAAGGATATAAGTGCATCAACTGCAAACTCTTGGTTCATAAG
                  ************************************************************

HsCD00037968      AAGTGCCATAAACTCGTCACAATTGAATGTGGGCGGCATTCTTTGCCACAGGAACCAGTG
NM_002740.5       AAGTGCCATAAACTCGTCACAATTGAATGTGGGCGGCATTCTTTGCCACAGGAACCAGTG
                  ************************************************************

HsCD00037968      ATGCCCATGGATCAGTCATCCATGCATTCTGACCATGCACAGACAGTAATTCCATATAAT
NM_002740.5       ATGCCCATGGATCAGTCATCCATGCATTCTGACCATGCACAGACAGTAATTCCATATAAT
                  ************************************************************

HsCD00037968      CCTTCAAGTCATGAGAGTTTGGATCAAGTTGGTGAAGAAAAAGAGGCAATGAACACCAGG
NM_002740.5       CCTTCAAGTCATGAGAGTTTGGATCAAGTTGGTGAAGAAAAAGAGGCAATGAACACCAGG
                  ************************************************************

HsCD00037968      GAAAGTGGCAAAGCTTCATCCAGTCTAGGTCTTCAGGATTTTGATTTGCTCCGGGTAATA
NM_002740.5       GAAAGTGGCAAAGCTTCATCCAGTCTAGGTCTTCAGGATTTTGATTTGCTCCGGGTAATA
                  ************************************************************

HsCD00037968      GGAAGAGGAAGTTATGCCAAAGTACTGTTGGTTCGATTAAAAAAAACAGATCGTATTTAT
NM_002740.5       GGAAGAGGAAGTTATGCCAAAGTACTGTTGGTTCGATTAAAAAAAACAGATCGTATTTAT
                  ************************************************************

HsCD00037968      GCAATGAAAGTTGTGAAAAAAGAGCTTGTTAATGATGATGAGGATATTGATTGGGTACAG
NM_002740.5       GCAATGAAAGTTGTGAAAAAAGAGCTTGTTAATGATGATGAGGATATTGATTGGGTACAG
                  ************************************************************

HsCD00037968      ACAGAGAAGCATGTGTTTGAGCAGGCATCCAATCATCCTTTCCTTGTTGGGCTGCATTCT
NM_002740.5       ACAGAGAAGCATGTGTTTGAGCAGGCATCCAATCATCCTTTCCTTGTTGGGCTGCATTCT
                  ************************************************************

HsCD00037968      TGCTTTCAGACAGAAAGCAGATTGTTCTTTGTTATAGAGTATGTAAATGGAGGAGACCTA
NM_002740.5       TGCTTTCAGACAGAAAGCAGATTGTTCTTTGTTATAGAGTATGTAAATGGAGGAGACCTA
                  ************************************************************

HsCD00037968      ATGTTTCATATGCAGCGACAAAGAAAACTTCCTGAAGAACATGCCAGATTTTACTCTGCA
NM_002740.5       ATGTTTCATATGCAGCGACAAAGAAAACTTCCTGAAGAACATGCCAGATTTTACTCTGCA
                  ************************************************************

HsCD00037968      GAAATCAGTCTAGCATTAAATTATCTTCATGAGCGAGGGATAATTTATAGAGATTTGAAA
NM_002740.5       GAAATCAGTCTAGCATTAAATTATCTTCATGAGCGAGGGATAATTTATAGAGATTTGAAA
                  ************************************************************

HsCD00037968      CTGGACAATGTATTACTGGACTCTGAAGGCCACATTAAACTCACTGACTACGGCATGTGT
NM_002740.5       CTGGACAATGTATTACTGGACTCTGAAGGCCACATTAAACTCACTGACTACGGCATGTGT
                  ************************************************************

HsCD00037968      AAGGAAGGATTACGGCCAGGAGATACAACCAGCACTTTCTGTGGTACTCCTAATTACATT
NM_002740.5       AAGGAAGGATTACGGCCAGGAGATACAACCAGCACTTTCTGTGGTACTCCTAATTACATT
                  ************************************************************

HsCD00037968      GCTCCTGAAATTTTAAGAGGAGAAGATTATGGTTTCAGTGTTGACTGGTGGGCTCTTGGA
NM_002740.5       GCTCCTGAAATTTTAAGAGGAGAAGATTATGGTTTCAGTGTTGACTGGTGGGCTCTTGGA
                  ************************************************************

HsCD00037968      GTGCTCATGTTTGAGATGATGGCAGGAAGGTCTCCATTTGATATTGTTGGGAGCTCCGAT
NM_002740.5       GTGCTCATGTTTGAGATGATGGCAGGAAGGTCTCCATTTGATATTGTTGGGAGCTCCGAT
                  ************************************************************

HsCD00037968      AACCCTGACCAGAACACAGAGGATTATCTCTTCCAAGTTATTTTGGAAAAACAAATTCGC
NM_002740.5       AACCCTGACCAGAACACAGAGGATTATCTCTTCCAAGTTATTTTGGAAAAACAAATTCGC
                  ************************************************************

HsCD00037968      ATACCACGTTCTCTGTCTGTAAAAGCTGCGAGTGTTCTGAAGAGTTTTCTTAATAAGGAC
NM_002740.5       ATACCACGTTCTCTGTCTGTAAAAGCTGCAAGTGTTCTGAAGAGTTTTCTTAATAAGGAC
                  *****************************.******************************

HsCD00037968      CCTAAGGAACGATTGGGTTGTCATCCTCAAACAGGATTTGCTGATATTCAGGGACACCCG
NM_002740.5       CCTAAGGAACGATTGGGTTGTCATCCTCAAACAGGATTTGCTGATATTCAGGGACACCCG
                  ************************************************************

HsCD00037968      TTCTTCCGAAATGTTGATTGGGATATGATGGAGCAAAAACAGGTGGTACCTCCCTTTAAA
NM_002740.5       TTCTTCCGAAATGTTGATTGGGATATGATGGAGCAAAAACAGGTGGTACCTCCCTTTAAA
                  ************************************************************

HsCD00037968      CCAAATATTTCTGGGGAATTTGGTTTGGACAACTTTGATTCTCAGTTTACTAATGAACCT
NM_002740.5       CCAAATATTTCTGGGGAATTTGGTTTGGACAACTTTGATTCTCAGTTTACTAATGAACCT
                  ************************************************************

HsCD00037968      GTCCAGCTCACTCCAGATGACGATGACATTGTGAGGAAGATTGATCAGTCTGAATTTGAA
NM_002740.5       GTCCAGCTCACTCCAGATGACGATGACATTGTGAGGAAGATTGATCAGTCTGAATTTGAA
                  ************************************************************

HsCD00037968      GGTTTTGAGTATATCAATCCTCTTTTGATGTCTGCAGAAGAATGTGTCTTG
NM_002740.5       GGTTTTGAGTATATCAATCCTCTTTTGATGTCTGCAGAAGAATGTGTCTGA
                  ************************************************* .

Pathways

NCI : IL1-mediated signaling events
NCI : Insulin Pathway
NCI : Insulin-mediated glucose transport
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : TNF receptor signaling pathway
NCI : p75(NTR)-mediated signaling
Panther : 5HT2 type receptor mediated signaling pathway
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Angiogenesis
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Panther : Histamine H1 receptor mediated signaling pathway
Panther : Muscarinic acetylcholine receptor 1 and 3 signaling pathway
Panther : Oxytocin receptor mediated signaling pathway
Panther : Thyrotropin-releasing hormone receptor signaling pathway
Panther : VEGF signaling pathway
Panther : Wnt signaling pathway
Reactome : Cell junction organization
Reactome : Cell-Cell communication
Reactome : Cell-cell junction organization
Reactome : Signal Transduction
Reactome : Signalling by NGF
Reactome : Tight junction interactions
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR recruits signalling complexes
Reactome : p75NTR signals via NF-kB
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Epithelium TarBase
WikiPathway : G Protein Signaling Pathways
WikiPathway : Insulin Signaling
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency
WikiPathway : miRs in Muscle Cell Differentiation

Clone

Cloning Information : 138533
HIP Master Clone ID : 87197
Original Clone ID : FLH138533.01L

Organism


TAX_ID : 9606
Species Specific ID: 5584

Genome

Chromosome : 3
Map Location : 3q26.3
Ensembl : ENSG00000163558

Reagents

Labome : PRKCI-antibody