DNASU Plasmid Repository • 480.965.5697 | Email

CHEK1 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CHEK1
Gene Name:  checkpoint kinase 1
Sequence             
Original Clone ID: FLH138534.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00037969

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1431nts         Open reading frame : 1 to 1431
Reference Sequence Alignment

ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
AAGCTGATTGATATTGTGAGCAGCCAGAAGGTTTGGCTTCCTGCCACATTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1465
Start on reference sequence 35
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CHEK1
Symbol Nomenclature : CHEK1
SYNONYM : CHK1
Designation : CHK1 checkpoint homolog|Checkpoint, S. pombe, homolog of, 1|Chk1-S|cell cycle checkpoint kinase|checkpoint kinase-1|serine/threonine-protein kinase Chk1
Full Nomenclature : checkpoint kinase 1
GENEID : 1111
HGNC : 1925
MIM : 603078
Vega : OTTHUMG00000165853
Target GenBank: NM_001274

 

Reference Sequence Alignment

  

HsCD00037969        ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
NM_001114121.2      ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
NM_001244846.1      ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
NM_001114122.2      ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
NM_001274.5         ATGGCAGTGCCCTTTGTGGAAGACTGGGACTTGGTGCAAACCCTGGGAGAAGGTGCCTAT
                    ************************************************************

HsCD00037969        GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
NM_001114121.2      GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
NM_001244846.1      GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
NM_001114122.2      GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
NM_001274.5         GGAGAAGTTCAACTTGCTGTGAATAGAGTAACTGAAGAAGCAGTCGCAGTGAAGATTGTA
                    ************************************************************

HsCD00037969        GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
NM_001114121.2      GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
NM_001244846.1      GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
NM_001114122.2      GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
NM_001274.5         GATATGAAGCGTGCCGTAGACTGTCCAGAAAATATTAAGAAAGAGATCTGTATCAATAAA
                    ************************************************************

HsCD00037969        ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
NM_001114121.2      ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
NM_001244846.1      ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
NM_001114122.2      ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
NM_001274.5         ATGCTAAATCATGAAAATGTAGTAAAATTCTATGGTCACAGGAGAGAAGGCAATATCCAA
                    ************************************************************

HsCD00037969        TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
NM_001114121.2      TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
NM_001244846.1      TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
NM_001114122.2      TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
NM_001274.5         TATTTATTTCTGGAGTACTGTAGTGGAGGAGAGCTTTTTGACAGAATAGAGCCAGACATA
                    ************************************************************

HsCD00037969        GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
NM_001114121.2      GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
NM_001244846.1      GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
NM_001114122.2      GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
NM_001274.5         GGCATGCCTGAACCAGATGCTCAGAGATTCTTCCATCAACTCATGGCAGGGGTGGTTTAT
                    ************************************************************

HsCD00037969        CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
NM_001114121.2      CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
NM_001244846.1      CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
NM_001114122.2      CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
NM_001274.5         CTGCATGGTATTGGAATAACTCACAGGGATATTAAACCAGAAAATCTTCTGTTGGATGAA
                    ************************************************************

HsCD00037969        AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
NM_001114121.2      AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
NM_001244846.1      AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
NM_001114122.2      AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
NM_001274.5         AGGGATAACCTCAAAATCTCAGACTTTGGCTTGGCAACAGTATTTCGGTATAATAATCGT
                    ************************************************************

HsCD00037969        GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
NM_001114121.2      GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
NM_001244846.1      GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
NM_001114122.2      GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
NM_001274.5         GAGCGTTTGTTGAACAAGATGTGTGGTACTTTACCATATGTTGCTCCAGAACTTCTGAAG
                    ************************************************************

HsCD00037969        AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
NM_001114121.2      AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
NM_001244846.1      AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
NM_001114122.2      AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
NM_001274.5         AGAAGAGAATTTCATGCAGAACCAGTTGATGTTTGGTCCTGTGGAATAGTACTTACTGCA
                    ************************************************************

HsCD00037969        ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
NM_001114121.2      ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
NM_001244846.1      ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
NM_001114122.2      ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
NM_001274.5         ATGCTCGCTGGAGAATTGCCATGGGACCAACCCAGTGACAGCTGTCAGGAGTATTCTGAC
                    ************************************************************

HsCD00037969        TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
NM_001114121.2      TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
NM_001244846.1      TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
NM_001114122.2      TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
NM_001274.5         TGGAAAGAAAAAAAAACATACCTCAACCCTTGGAAAAAAATCGATTCTGCTCCTCTAGCT
                    ************************************************************

HsCD00037969        CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
NM_001114121.2      CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
NM_001244846.1      CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
NM_001114122.2      CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
NM_001274.5         CTGCTGCATAAAATCTTAGTTGAGAATCCATCAGCAAGAATTACCATTCCAGACATCAAA
                    ************************************************************

HsCD00037969        AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
NM_001114121.2      AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
NM_001244846.1      AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
NM_001114122.2      AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
NM_001274.5         AAAGATAGATGGTACAACAAACCCCTCAAGAAAGGGGCAAAAAGGCCCCGAGTCACTTCA
                    ************************************************************

HsCD00037969        GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
NM_001114121.2      GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
NM_001244846.1      GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
NM_001114122.2      GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
NM_001274.5         GGTGGTGTGTCAGAGTCTCCCAGTGGATTTTCTAAGCACATTCAATCCAATTTGGACTTC
                    ************************************************************

HsCD00037969        TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
NM_001114121.2      TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
NM_001244846.1      TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
NM_001114122.2      TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
NM_001274.5         TCTCCAGTAAACAGTGCTTCTAGTGAAGAAAATGTGAAGTACTCCAGTTCTCAGCCAGAA
                    ************************************************************

HsCD00037969        CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
NM_001114121.2      CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
NM_001244846.1      CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
NM_001114122.2      CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
NM_001274.5         CCCCGCACAGGTCTTTCCTTATGGGATACCAGCCCCTCATACATTGATAAATTGGTACAA
                    ************************************************************

HsCD00037969        GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
NM_001114121.2      GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
NM_001244846.1      GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
NM_001114122.2      GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
NM_001274.5         GGGATCAGCTTTTCCCAGCCCACATGTCCTGATCATATGCTTTTGAATAGTCAGTTACTT
                    ************************************************************

HsCD00037969        GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
NM_001114121.2      GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
NM_001244846.1      GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
NM_001114122.2      GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
NM_001274.5         GGCACCCCAGGATCCTCACAGAACCCCTGGCAGCGGTTGGTCAAAAGAATGACACGATTC
                    ************************************************************

HsCD00037969        TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
NM_001114121.2      TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
NM_001244846.1      TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
NM_001114122.2      TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
NM_001274.5         TTTACCAAATTGGATGCAGACAAATCTTATCAATGCCTGAAAGAGACTTGTGAGAAGTTG
                    ************************************************************

HsCD00037969        GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
NM_001114121.2      GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
NM_001244846.1      GGCTATCAATGGAAGAAAAGTTGTATGAATCAG---------------------------
NM_001114122.2      GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
NM_001274.5         GGCTATCAATGGAAGAAAAGTTGTATGAATCAGGTTACTATATCAACAACTGATAGGAGA
                    *********************************                           

HsCD00037969        AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
NM_001114121.2      AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
NM_001244846.1      ------------------------------------------------------------
NM_001114122.2      AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
NM_001274.5         AACAATAAACTCATTTTCAAAGTGAATTTGTTAGAAATGGATGATAAAATATTGGTTGAC
                                                                                

HsCD00037969        TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
NM_001114121.2      TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
NM_001244846.1      ---------------GGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
NM_001114122.2      TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
NM_001274.5         TTCCGGCTTTCTAAGGGTGATGGATTGGAGTTCAAGAGACACTTCCTGAAGATTAAAGGG
                                   *********************************************

HsCD00037969        AAGCTGATTGATATTGTGAGCAGCCAGAAGGTTTGGCTTCCTGCCACATTG
NM_001114121.2      AAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGA
NM_001244846.1      AAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGA
NM_001114122.2      AAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGA
NM_001274.5         AAGCTGATTGATATTGTGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGA
                    ******************************.****************** .

Pathways

NCI : ATR signaling pathway
NCI : Circadian rhythm pathway
NCI : Fanconi anemia pathway
NCI : p53 pathway
NCI : p73 transcription factor network
Reactome : Activation of ATR in response to replication stress
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Chk1/Chk2(Cds1) mediated inactivation of Cyclin B:Cdk1 complex
Reactome : G1/S DNA Damage Checkpoints
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : Signal Transduction
Reactome : Signaling by SCF-KIT
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 138534
HIP Master Clone ID : 87198
Original Clone ID : FLH138534.01L

Organism


TAX_ID : 9606
Species Specific ID: 1111

Genome

Chromosome : 11
Map Location : 11q24.2
Ensembl : ENSG00000149554

Reagents

Labome : Chk1-antibody