DNASU Plasmid Repository • 480.965.5697 | Email

MAPKAPK2 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAPKAPK2
Gene Name:  mitogen-activated protein kinase-activated protein kinase 2
Sequence             
Original Clone ID: FLH138548.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00037983

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1065nts         Open reading frame : 1 to 1065
Reference Sequence Alignment

ATGCTGTCCAACTCCCAGGGCCAGAGCCCGCCGGTGCCGTTCCCCGCCCCTGCCCCGCCG
CCGCAGCCCCCGCAGCAGTTCCCGCAGTTCCACGTCAAGTCCGGCCTGCAGATCAAGAAG
AACGCCATCATCGATGACTACAAGGTCACCAGCCAGGTCCTGGGGCTGGGCATCAACGGC
AAAGTTTTGCAGATCTTCAACAAGAGGACCCAGGAGAAATTCGCCCTCAAAATGCTTCAG
GACTGCCCCAAGGCCCGCAGGGAGGTGGAGCTGCACTGGCGGGCCTCCCAGTGCCCGCAC
ATCGTACGGATCGTGGATGTGTACGAGAATCTGTACGCAGGGAGGAAGTGCCTGCTGATT
GTCATGGAATGTTTGGACGGTGGAGAACTCTTTAGCCGAATCCAGGATCGAGGAGACCAG
GCATTCACAGAAAGAGAAGCATCCGAAATCATGAAGAGCATCGGTGAGGCCATCCAGTAT
CTGCATTCAATCAACATTGCCCATCGGGATGTCAAGCCTGAGAATCTCTTATACACCTCC
AAAAGGCCCAACGCCATCCTGAAACTCACTGACTTTGGCTTTGCCAAGGAAACCACCAGC
CACAACTCTTTGACCACTCCTTGTTATACACCGTACTATGTGGCTCCAGAAGTGCTGGGT
CCAGAGAAGTATGACAAGTCCTGTGACATGTGGTCCCTGGGTGTCATCATGTACATCCTG
CTGTGTGGGTATCCCCCCTTCTACTCCAACCACGGCCTTGCCATCTCTCCGGGCATGAAG
ACTCGCATCCGAATGGGCCAGTATGAATTTCCCAACCCAGAATGGTCAGAAGTATCAGAG
GAAGTGAAGATGCTCATTCGGAATCTGCTGAAAACAGAGCCCACCCAGAGAATGACCATC
ACCGAGTTTATGAACCACCCTTGGATCATGCAATCAACAAAGGTCCCTCAAACCCCACTG
CACACCAGCCGGGTCCTGAAGGAGGACAAGGAGCGGTGGGAGGATGTCAAGGGGTGTCTT
CATGACAAGAACAGCGACCAGGCCACTTGGCTGACCAGGTTGTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1491
Start on reference sequence 379
Mutations:
None
Discrepancy:
del@73,48
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAPKAPK2
Symbol Nomenclature : MAPKAPK2
SYNONYM : MAPKAP-K2; MK-2; MK2
Designation : MAP kinase-activated protein kinase 2|MAPK-activated protein kinase 2|MAPKAP kinase 2
Full Nomenclature : mitogen-activated protein kinase-activated protein kinase 2
GENEID : 9261
HGNC : 6887
MIM : 602006
Vega : OTTHUMG00000036342
Target GenBank: NM_004759

 

Reference Sequence Alignment

  

HsCD00037983      ATGCTGTCCAACTCCCAGGGCCAGAGCCCGCCGGTGCCGTTCCCCGCCCCTGCCCCGCCG
NM_004759.4       ATGCTGTCCAACTCCCAGGGCCAGAGCCCGCCGGTGCCGTTCCCCGCCCCGGCCCCGCCG
NM_032960.3       ATGCTGTCCAACTCCCAGGGCCAGAGCCCGCCGGTGCCGTTCCCCGCCCCGGCCCCGCCG
                  ************************************************** *********

HsCD00037983      CCGCAG------------------------------------------------CCCCCG
NM_004759.4       CCGCAGCCCCCCACCCCTGCCCTGCCGCACCCCCCGGCGCAGCCGCCGCCGCCGCCCCCG
NM_032960.3       CCGCAGCCCCCCACCCCTGCCCTGCCGCACCCCCCGGCGCAGCCGCCGCCGCCGCCCCCG
                  ******                                                ******

HsCD00037983      CAGCAGTTCCCGCAGTTCCACGTCAAGTCCGGCCTGCAGATCAAGAAGAACGCCATCATC
NM_004759.4       CAGCAGTTCCCGCAGTTCCACGTCAAGTCCGGCCTGCAGATCAAGAAGAACGCCATCATC
NM_032960.3       CAGCAGTTCCCGCAGTTCCACGTCAAGTCCGGCCTGCAGATCAAGAAGAACGCCATCATC
                  ************************************************************

HsCD00037983      GATGACTACAAGGTCACCAGCCAGGTCCTGGGGCTGGGCATCAACGGCAAAGTTTTGCAG
NM_004759.4       GATGACTACAAGGTCACCAGCCAGGTCCTGGGGCTGGGCATCAACGGCAAAGTTTTGCAG
NM_032960.3       GATGACTACAAGGTCACCAGCCAGGTCCTGGGGCTGGGCATCAACGGCAAAGTTTTGCAG
                  ************************************************************

HsCD00037983      ATCTTCAACAAGAGGACCCAGGAGAAATTCGCCCTCAAAATGCTTCAGGACTGCCCCAAG
NM_004759.4       ATCTTCAACAAGAGGACCCAGGAGAAATTCGCCCTCAAAATGCTTCAGGACTGCCCCAAG
NM_032960.3       ATCTTCAACAAGAGGACCCAGGAGAAATTCGCCCTCAAAATGCTTCAGGACTGCCCCAAG
                  ************************************************************

HsCD00037983      GCCCGCAGGGAGGTGGAGCTGCACTGGCGGGCCTCCCAGTGCCCGCACATCGTACGGATC
NM_004759.4       GCCCGCAGGGAGGTGGAGCTGCACTGGCGGGCCTCCCAGTGCCCGCACATCGTACGGATC
NM_032960.3       GCCCGCAGGGAGGTGGAGCTGCACTGGCGGGCCTCCCAGTGCCCGCACATCGTACGGATC
                  ************************************************************

HsCD00037983      GTGGATGTGTACGAGAATCTGTACGCAGGGAGGAAGTGCCTGCTGATTGTCATGGAATGT
NM_004759.4       GTGGATGTGTACGAGAATCTGTACGCAGGGAGGAAGTGCCTGCTGATTGTCATGGAATGT
NM_032960.3       GTGGATGTGTACGAGAATCTGTACGCAGGGAGGAAGTGCCTGCTGATTGTCATGGAATGT
                  ************************************************************

HsCD00037983      TTGGACGGTGGAGAACTCTTTAGCCGAATCCAGGATCGAGGAGACCAGGCATTCACAGAA
NM_004759.4       TTGGACGGTGGAGAACTCTTTAGCCGAATCCAGGATCGAGGAGACCAGGCATTCACAGAA
NM_032960.3       TTGGACGGTGGAGAACTCTTTAGCCGAATCCAGGATCGAGGAGACCAGGCATTCACAGAA
                  ************************************************************

HsCD00037983      AGAGAAGCATCCGAAATCATGAAGAGCATCGGTGAGGCCATCCAGTATCTGCATTCAATC
NM_004759.4       AGAGAAGCATCCGAAATCATGAAGAGCATCGGTGAGGCCATCCAGTATCTGCATTCAATC
NM_032960.3       AGAGAAGCATCCGAAATCATGAAGAGCATCGGTGAGGCCATCCAGTATCTGCATTCAATC
                  ************************************************************

HsCD00037983      AACATTGCCCATCGGGATGTCAAGCCTGAGAATCTCTTATACACCTCCAAAAGGCCCAAC
NM_004759.4       AACATTGCCCATCGGGATGTCAAGCCTGAGAATCTCTTATACACCTCCAAAAGGCCCAAC
NM_032960.3       AACATTGCCCATCGGGATGTCAAGCCTGAGAATCTCTTATACACCTCCAAAAGGCCCAAC
                  ************************************************************

HsCD00037983      GCCATCCTGAAACTCACTGACTTTGGCTTTGCCAAGGAAACCACCAGCCACAACTCTTTG
NM_004759.4       GCCATCCTGAAACTCACTGACTTTGGCTTTGCCAAGGAAACCACCAGCCACAACTCTTTG
NM_032960.3       GCCATCCTGAAACTCACTGACTTTGGCTTTGCCAAGGAAACCACCAGCCACAACTCTTTG
                  ************************************************************

HsCD00037983      ACCACTCCTTGTTATACACCGTACTATGTGGCTCCAGAAGTGCTGGGTCCAGAGAAGTAT
NM_004759.4       ACCACTCCTTGTTATACACCGTACTATGTGGCTCCAGAAGTGCTGGGTCCAGAGAAGTAT
NM_032960.3       ACCACTCCTTGTTATACACCGTACTATGTGGCTCCAGAAGTGCTGGGTCCAGAGAAGTAT
                  ************************************************************

HsCD00037983      GACAAGTCCTGTGACATGTGGTCCCTGGGTGTCATCATGTACATCCTGCTGTGTGGGTAT
NM_004759.4       GACAAGTCCTGTGACATGTGGTCCCTGGGTGTCATCATGTACATCCTGCTGTGTGGGTAT
NM_032960.3       GACAAGTCCTGTGACATGTGGTCCCTGGGTGTCATCATGTACATCCTGCTGTGTGGGTAT
                  ************************************************************

HsCD00037983      CCCCCCTTCTACTCCAACCACGGCCTTGCCATCTCTCCGGGCATGAAGACTCGCATCCGA
NM_004759.4       CCCCCCTTCTACTCCAACCACGGCCTTGCCATCTCTCCGGGCATGAAGACTCGCATCCGA
NM_032960.3       CCCCCCTTCTACTCCAACCACGGCCTTGCCATCTCTCCGGGCATGAAGACTCGCATCCGA
                  ************************************************************

HsCD00037983      ATGGGCCAGTATGAATTTCCCAACCCAGAATGGTCAGAAGTATCAGAGGAAGTGAAGATG
NM_004759.4       ATGGGCCAGTATGAATTTCCCAACCCAGAATGGTCAGAAGTATCAGAGGAAGTGAAGATG
NM_032960.3       ATGGGCCAGTATGAATTTCCCAACCCAGAATGGTCAGAAGTATCAGAGGAAGTGAAGATG
                  ************************************************************

HsCD00037983      CTCATTCGGAATCTGCTGAAAACAGAGCCCACCCAGAGAATGACCATCACCGAGTTTATG
NM_004759.4       CTCATTCGGAATCTGCTGAAAACAGAGCCCACCCAGAGAATGACCATCACCGAGTTTATG
NM_032960.3       CTCATTCGGAATCTGCTGAAAACAGAGCCCACCCAGAGAATGACCATCACCGAGTTTATG
                  ************************************************************

HsCD00037983      AACCACCCTTGGATCATGCAATCAACAAAGGTCCCTCAAACCCCACTGCACACCAGCCGG
NM_004759.4       AACCACCCTTGGATCATGCAATCAACAAAGGTCCCTCAAACCCCACTGCACACCAGCCGG
NM_032960.3       AACCACCCTTGGATCATGCAATCAACAAAGGTCCCTCAAACCCCACTGCACACCAGCCGG
                  ************************************************************

HsCD00037983      GTCCTGAAGGAGGACAAGGAGCGGTGGGAGGATGTCAAGGGGTG----------------
NM_004759.4       GTCCTGAAGGAGGACAAGGAGCGGTGGGAGGATGTCAAGGGGTG----------------
NM_032960.3       GTCCTGAAGGAGGACAAGGAGCGGTGGGAGGATGTCAAGGAGGAGATGACCAGTGCCTTG
                  ****************************************.* .                

HsCD00037983      ----------------------------------TCTTCATGACAAGAACAGCGACCAGG
NM_004759.4       ----------------------------------TCTTCATGACAAGAACAGCGACCAGG
NM_032960.3       GCCACAATGCGCGTTGACTACGAGCAGATCAAGATAAAAAAGATTGAAGATGCATCCAAC
                                                    *.::.*:** :..*..:**.:***. 

HsCD00037983      CCACTTGGCTGACCAGGTTGTTG-------------------------------------
NM_004759.4       CCACTTGGCTGACCAGGTTGTGA-------------------------------------
NM_032960.3       CCTCTGCTGCTGAAGAGGCGGAAGAAAGCTCGGGCCCTGGAGGCTGCGGCTCTGGCCCAC
                  **:**      .....*  *  .                                     

HsCD00037983      ---
NM_004759.4       ---
NM_032960.3       TGA
                     

Pathways

NCI : IL2-mediated signaling events
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling mediated by p38-alpha and p38-beta
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : p38 signaling mediated by MAPKAP kinases
Panther : Angiogenesis
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : VEGF signaling pathway
Panther : p38 MAPK pathway
Reactome : Activated TLR4 signalling
Reactome : Arachidonic acid metabolism
Reactome : Butyrate Response Factor 1 (BRF1) destabilizes mRNA
Reactome : CREB phosphorylation
Reactome : Cellular Senescence
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Gene Expression
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : Metabolism
Reactome : Metabolism of RNA
Reactome : Metabolism of lipids and lipoproteins
Reactome : Metabolism of mRNA
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Oxidative Stress Induced Senescence
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Signal Transduction
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Synthesis of Leukotrienes (LT) and Eoxins (EX)
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : Tristetraprolin (TTP) destabilizes mRNA
Reactome : activated TAK1 mediates p38 MAPK activation
Reactome : p38MAPK events
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : IL-1 signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : Serotonin Receptor 2 and ELK-SRF/GATA4 signaling
WikiPathway : Serotonin Receptor 4/6/7 and NR3C Signaling
WikiPathway : p38 MAPK Signaling Pathway

Clone

Cloning Information : 138548
HIP Master Clone ID : 87212
Original Clone ID : FLH138548.01L

Organism


TAX_ID : 9606
Species Specific ID: 9261

Genome

Chromosome : 1
Map Location : 1q32
Ensembl : ENSG00000162889

Reagents

Labome : MK2-antibody