DNASU Plasmid Repository • 480.965.5697 | Email

PIK4CA (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  PI4KA
Gene Name:  phosphatidylinositol 4-kinase, catalytic, alpha
Original Clone ID: FLH138612.01L
Keyword: short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 2565nts        
Open reading frame : 1 to 2565
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
Start on reference sequence 149
End on reference sequence 2713
5' Linker Sequence: None
3' Linker Sequence: None


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : PI4KA
Symbol Nomenclature : PI4KA
Designation : PI4-kinase alpha|phosphatidylinositol 4-kinase 230|phosphatidylinositol 4-kinase alpha|phosphatidylinositol 4-kinase, type III, alpha|ptdIns-4-kinase alpha
Full Nomenclature : phosphatidylinositol 4-kinase, catalytic, alpha
GENEID : 5297
HGNC : 8983
MIM : 600286
Vega : OTTHUMG00000167440
Target GenBank: BC018120


Reference Sequence Alignment


HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
XM_005261635.1      ---------------------------------ATGCACCTACGCCTGCGCCCTGAGGTC
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------ATGCGGGAGATGGCAGGGGCCTGGCACATGACGGTG
NM_002650.2         ------------------------ATGCGGGAGATGGCAGGGGCCTGGCACATGACGGTG
                                            :  *   :*.* .*.    **:* .* .:*.*. **

                     .* . .:. *  .  : :: **:** .:**:.** **..*.*:*.***  ****.   *

                    ..:*...  *... **.:. *:  ..**   :.*: .**** *.* * .* *  . . :*

                    :**.: .:**:* . ** *. **  ***. ***  *. *****:  *.            

HsCD00038041        ------------------------------------------------------------
NM_058004.3         ------------------------------------------------------------
XM_005261634.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_058004.3         ------------------------------------------------------------
XM_005261634.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------------------------------
NM_058004.3         ------------------------------------------------------------
XM_005261634.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        -------------------------------TGGAGATCTTCTCCAGCCTGCTGCAGCGC
NM_058004.3         -------------------------------TGGAGATCTTCTCCAGCCTGCTGCAGCGC
XM_005261634.1      -------------------------------TGGAGATCTTCTCCAGCCTGCTGCAGCGC
NM_002650.2         -------------------------------TGGAGATCTTCTCCAGCCTGCTGCAGCGC
                                                   ***:**:****:.*..*.* *: .**.* 

                    : .* *:   **....:*..  .   .:. ** .  .**.* ..* :     .    .**

                     **. * * :  .:****.:****.**  * : : *** *:*..     .: **  :* .

                    *. **:.. ** *.*** *: *: *   * :* .:*::* **.. ***    ** . :**

                    *    ***  ..*.**:* .:.* *.:*.... *:   *.:* .  :.*. . *.**:  

                    . *** *:. *  .*.. ******:: * .*.:.. *.  :*.  *.  **..**:**: 

HsCD00038041        GTTCCCCCAGATAATCAGGACACCCGG---------------------------------
NM_058004.3         GTTCCCCCAGATAATCAGGACACCCGG---------------------------------
XM_005261634.1      GTTCCCCCAGATAATCAGGACACCCGG---------------------------------
NM_002650.2         GTTCCCCCAGATAATCAGGACACCCGG---------------------------------
                    *:: . * ..* **:**  * *.* **                                 

HsCD00038041        ------------------------------------------------------------
NM_058004.3         ------------------------------------------------------------
XM_005261634.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------

HsCD00038041        ------------------------------------AGCAACCTGGACATAACTGTCGGC
NM_058004.3         ------------------------------------AGCAACCTGGACATAACTGTCGGC
XM_005261634.1      ------------------------------------AGCAACCTGGACATAACTGTCGGC
NM_002650.2         ------------------------------------AGCAACCTGGACATAACTGTCGGC
                                                        *...** :  .**:.:  .* * .

                    ** * *.*:*:.  **.**.. .*  *. *.* . .**   ..**:  .*   *: .  *

                    **** .  *.***:.**:*.*.**:. **.*:.*  .:**.**.   .**   . . ::*

                     ** .**  .* *  ..*..  : . **:* **.** * .. .  .. . ..:**  .* 

                    * ** ::.. * :.  . * * ..  **   *:*:  :.  . .  .  **  . .**: 

                    : *.: *. .*  * * . . *.* .*.* . *   :* ***:.**:*  *.. *.*** 

                    *: ... * *..  *.  :**:  *   * .*.**.* * .   **. .  * * * .**

                    .* *.* ::* *.*    :. *.:*:** ...  :.* : .     :  * * . * *::

                    . :..* :.** .** *.:  ..   * :.** ***   ***:.**** . . ***    

                    * .*:**: .*  :**:*.*   *:.* .   **   .  ..*... .*. .*** **.*

                    : *   .  .:* .* * . * .**  .:**  *   .* .*..** **...* .: ***

                     .* *  *  * .:**  . ** ****:* .* *  .. .* * **:* *****. * * 

                    *.*.* .***   .:.:   ... :: .  .:   *  :    . **.: * *    .  

                    **. :  * *:*:**:* :. .  ...*. ::*. *:.**:**.:**..** * *: *. 

HsCD00038041        AAAGACCCTG--------------------------------------------------
NM_058004.3         AAAGACCCTG--------------------------------------------------
XM_005261634.1      AAAGACCCTG--------------------------------------------------
NM_002650.2         AAAGACCCTG--------------------------------------------------
                    .*****. :.                                                  

HsCD00038041        ----------------------------ACATCGGCGACCTCCTGGATCAGTTGGTAGAG
NM_058004.3         ----------------------------ACATCGGCGACCTCCTGGATCAGTTGGTAGAG
XM_005261634.1      ----------------------------ACATCGGCGACCTCCTGGATCAGTTGGTAGAG
NM_002650.2         ----------------------------ACATCGGCGACCTCCTGGATCAGTTGGTAGAG




















                    **************** .


NCI : Integrins in angiogenesis
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Phospholipid metabolism
Reactome : PI Metabolism
Reactome : Synthesis of PIPs at the ER membrane
Reactome : Synthesis of PIPs at the Golgi membrane


Cloning Information : 138612
HIP Master Clone ID : 87276
Original Clone ID : FLH138612.01L


TAX_ID : 9606
Species Specific ID: 5297


Chromosome : 22
Map Location : 22q11.21
Ensembl : ENSG00000241973


Labome : PI4KA-antibody