DNASU Plasmid Repository • 480.965.5697 | Email

PIK3CB (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  PIK3CB
Gene Name:  phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
Original Clone ID: FLH138504.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 3213nts        
Open reading frame : 1 to 3213
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
Start on reference sequence 1
End on reference sequence 3213
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : PIK3CB
Symbol Nomenclature : PIK3CB
Designation : PI3-kinase p110 subunit beta|PI3-kinase subunit beta|PI3K-beta|PtdIns-3-kinase p110|phosphatidylinositol 4,5-bisphosphate 3-kinase 110 kDa catalytic subunit beta|phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit beta isoform|phosphatidylinositol-4,5-bisphosphate 3-kinase 110 kDa catalytic subunit beta|phosphoinositide-3-kinase, catalytic, beta polypeptide|ptdIns-3-kinase subunit beta|ptdIns-3-kinase subunit p110-beta
Full Nomenclature : phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta
GENEID : 5291
HGNC : 8976
MIM : 602925
Target GenBank: NM_006219


Reference Sequence Alignment



























XM_005247532.1      CAACCTTATTATTACCCTCCCTTCGATAAGAG----------------------------

XM_005247532.1      -----------------------TCGAGGTGGAAAAAAGTTTCTTCCTGTATTGAAAGAA





























NCI : Class I PI3K signaling events
NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : EGF receptor (ErbB1) signaling pathway
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : ErbB4 signaling events
NCI : FAS (CD95) signaling pathway
NCI : Internalization of ErbB1
NCI : LPA receptor mediated events
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : PDGFR-beta signaling pathway
NCI : Signaling events mediated by TCPTP
NCI : TRAIL signaling pathway
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : Axon guidance mediated by netrin
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : Interleukin signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Panther : PDGF signaling pathway
Panther : PI3 kinase pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Reactome : Adaptive Immune System
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Downstream TCR signaling
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : GAB1 signalosome
Reactome : GPVI-mediated activation cascade
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Nephrin interactions
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Phospholipid metabolism
Reactome : PI Metabolism
Reactome : PI-3K cascade
Reactome : PI3K Cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT activation
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PIP3 activates AKT signaling
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of signaling by CBL
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Role of phospholipids in phagocytosis
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signalling by NGF
Reactome : Synthesis of PIPs at the plasma membrane
Reactome : TCR signaling
Reactome : Tie2 Signaling
WikiPathway : AMPK signaling
WikiPathway : Focal Adhesion
WikiPathway : G13 Signaling Pathway
WikiPathway : Insulin Signaling
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway


Cloning Information : 138504
HIP Master Clone ID : 87305
Original Clone ID : FLH138504.01L


TAX_ID : 9606
Species Specific ID: 5291


Chromosome : 3
Map Location : 3q22.3


Labome : PIK3CB-antibody