DNASU Plasmid Repository • 480.965.5697 | Email

CDK7 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDK7
Gene Name:  cyclin-dependent kinase 7
Sequence             
Original Clone ID: FLH136175.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038096

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1041nts         Open reading frame : 1 to 1041
Reference Sequence Alignment

ATGGCTCTGGACGTGAAGTCTCGGGCAAAGCGTTATGAGAAGCTGGACTTCCTTGGGGAG
GGACAGTTTGCCACCGTTTACAAGGCCAGAGATAAGAATACCAACCAAATTGTCGCCATT
AAGAAAATCAAACTTGGACATAGATCAGAAGCTAAAGATGGTATAAATAGAACCGCCTTA
AGAGAGATAAAATTATTACAGGAGCTAAGTCATCCAAATATAATTGGTCTCCTTGATGCT
TTTGGACATAAATCTAATATTAGCCTTGTCTTTGATTTTATGGAAACTGATCTAGAGGTT
ATAATAAAGGATAATAGTCTTGTGCTGACACCATCACACATCAAAGCCTACATGTTGATG
ACTCTTCAAGGATTAGAATATTTACATCAACATTGGATCCTACATAGGGATCTGAAACCA
AACAACTTGTTGCTAGATGAAAATGGAGTTCTAAAACTGGCAGATTTTGGCCTGGCCAAA
TCTTTTGGGAGCCCCAATAGAGCTTATACACATCAGGTTGTAACCAGGTGGTATCGGGCC
CCCGAGTTACTATTTGGAGCTAGGATGTATGGTGTAGGTGTGGACATGTGGGCTGTTGGC
TGTATATTAGCAGAGTTACTTCTAAGGGTTCCTTTTTTGCCAGGAGATTCAGACCTTGAT
CAGCTAACAAGAATATTTGAAACTTTGGGCACACCAACTGAGGAACAGTGGCCGGACATG
TGTAGTCTTCCAGATTATGTGACATTTAAGAGTTTCCCTGGAATACCTTTGCATCACATC
TTCAGTGCAGCAGGAGACGACTTACTAGATCTCATACAAGGCTTATTCTTATTTAATCCA
TGTGCTCGAATTACGGCCACACAGGCACTGAAAATGAAGTATTTCAGTAATCGGCCAGGG
CCAACACCTGGATGTCAGCTGCCAAGACCAAACTGTCCAGTGGAAACCTTAAAGGAGCAA
TCAAATCCAGCTTTGGCAATAAAAAGGAAAAGAACAGAGGCCTTAGAACAAGGAGGATTG
CCCAAGAAACTAATTTTTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1075
Start on reference sequence 35
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDK7
Symbol Nomenclature : CDK7
SYNONYM : CAK1; CDKN7; HCAK; MO15; STK1; p39MO15
Designation : 39 KDa protein kinase|CAK|CDK-activating kinase 1|TFIIH basal transcription factor complex kinase subunit|cell division protein kinase 7|cyclin-dependent kinase 7 (MO15 homolog, Xenopus laevis, cdk-activating kinase)|homolog of Xenopus MO15 Cdk-activating kinase|kinase subunit of CAK|p39 Mo15|protein kinase|serine/threonine kinase stk1|serine/threonine protein kinase 1|serine/threonine protein kinase MO15|serine/threonine-protein kinase 1
Full Nomenclature : cyclin-dependent kinase 7
GENEID : 1022
HGNC : 1778
MIM : 601955
Vega : OTTHUMG00000099358
Target GenBank: NM_001799

 

Reference Sequence Alignment

  

HsCD00038096      ATGGCTCTGGACGTGAAGTCTCGGGCAAAGCGTTATGAGAAGCTGGACTTCCTTGGGGAG
NM_001799.3       ATGGCTCTGGACGTGAAGTCTCGGGCAAAGCGTTATGAGAAGCTGGACTTCCTTGGGGAG
                  ************************************************************

HsCD00038096      GGACAGTTTGCCACCGTTTACAAGGCCAGAGATAAGAATACCAACCAAATTGTCGCCATT
NM_001799.3       GGACAGTTTGCCACCGTTTACAAGGCCAGAGATAAGAACACCAACCAAATTGTCGCCATT
                  ************************************** *********************

HsCD00038096      AAGAAAATCAAACTTGGACATAGATCAGAAGCTAAAGATGGTATAAATAGAACCGCCTTA
NM_001799.3       AAGAAAATCAAACTTGGACATAGATCAGAAGCTAAAGATGGTATAAATAGAACCGCCTTA
                  ************************************************************

HsCD00038096      AGAGAGATAAAATTATTACAGGAGCTAAGTCATCCAAATATAATTGGTCTCCTTGATGCT
NM_001799.3       AGAGAGATAAAATTATTACAGGAGCTAAGTCATCCAAATATAATTGGTCTCCTTGATGCT
                  ************************************************************

HsCD00038096      TTTGGACATAAATCTAATATTAGCCTTGTCTTTGATTTTATGGAAACTGATCTAGAGGTT
NM_001799.3       TTTGGACATAAATCTAATATTAGCCTTGTCTTTGATTTTATGGAAACTGATCTAGAGGTT
                  ************************************************************

HsCD00038096      ATAATAAAGGATAATAGTCTTGTGCTGACACCATCACACATCAAAGCCTACATGTTGATG
NM_001799.3       ATAATAAAGGATAATAGTCTTGTGCTGACACCATCACACATCAAAGCCTACATGTTGATG
                  ************************************************************

HsCD00038096      ACTCTTCAAGGATTAGAATATTTACATCAACATTGGATCCTACATAGGGATCTGAAACCA
NM_001799.3       ACTCTTCAAGGATTAGAATATTTACATCAACATTGGATCCTACATAGGGATCTGAAACCA
                  ************************************************************

HsCD00038096      AACAACTTGTTGCTAGATGAAAATGGAGTTCTAAAACTGGCAGATTTTGGCCTGGCCAAA
NM_001799.3       AACAACTTGTTGCTAGATGAAAATGGAGTTCTAAAACTGGCAGATTTTGGCCTGGCCAAA
                  ************************************************************

HsCD00038096      TCTTTTGGGAGCCCCAATAGAGCTTATACACATCAGGTTGTAACCAGGTGGTATCGGGCC
NM_001799.3       TCTTTTGGGAGCCCCAATAGAGCTTATACACATCAGGTTGTAACCAGGTGGTATCGGGCC
                  ************************************************************

HsCD00038096      CCCGAGTTACTATTTGGAGCTAGGATGTATGGTGTAGGTGTGGACATGTGGGCTGTTGGC
NM_001799.3       CCCGAGTTACTATTTGGAGCTAGGATGTATGGTGTAGGTGTGGACATGTGGGCTGTTGGC
                  ************************************************************

HsCD00038096      TGTATATTAGCAGAGTTACTTCTAAGGGTTCCTTTTTTGCCAGGAGATTCAGACCTTGAT
NM_001799.3       TGTATATTAGCAGAGTTACTTCTAAGGGTTCCTTTTTTGCCAGGAGATTCAGACCTTGAT
                  ************************************************************

HsCD00038096      CAGCTAACAAGAATATTTGAAACTTTGGGCACACCAACTGAGGAACAGTGGCCGGACATG
NM_001799.3       CAGCTAACAAGAATATTTGAAACTTTGGGCACACCAACTGAGGAACAGTGGCCGGACATG
                  ************************************************************

HsCD00038096      TGTAGTCTTCCAGATTATGTGACATTTAAGAGTTTCCCTGGAATACCTTTGCATCACATC
NM_001799.3       TGTAGTCTTCCAGATTATGTGACATTTAAGAGTTTCCCTGGAATACCTTTGCATCACATC
                  ************************************************************

HsCD00038096      TTCAGTGCAGCAGGAGACGACTTACTAGATCTCATACAAGGCTTATTCTTATTTAATCCA
NM_001799.3       TTCAGTGCAGCAGGAGACGACTTACTAGATCTCATACAAGGCTTATTCTTATTTAATCCA
                  ************************************************************

HsCD00038096      TGTGCTCGAATTACGGCCACACAGGCACTGAAAATGAAGTATTTCAGTAATCGGCCAGGG
NM_001799.3       TGTGCTCGAATTACGGCCACACAGGCACTGAAAATGAAGTATTTCAGTAATCGGCCAGGG
                  ************************************************************

HsCD00038096      CCAACACCTGGATGTCAGCTGCCAAGACCAAACTGTCCAGTGGAAACCTTAAAGGAGCAA
NM_001799.3       CCAACACCTGGATGTCAGCTGCCAAGACCAAACTGTCCAGTGGAAACCTTAAAGGAGCAA
                  ************************************************************

HsCD00038096      TCAAATCCAGCTTTGGCAATAAAAAGGAAAAGAACAGAGGCCTTAGAACAAGGAGGATTG
NM_001799.3       TCAAATCCAGCTTTGGCAATAAAAAGGAAAAGAACAGAGGCCTTAGAACAAGGAGGATTG
                  ************************************************************

HsCD00038096      CCCAAGAAACTAATTTTTTTG
NM_001799.3       CCCAAGAAACTAATTTTTTAA
                  *******************:.

Pathways

NCI : Retinoic acid receptors-mediated signaling
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cyclin A/B1 associated events during G2/M transition
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin D associated events in G1
Reactome : Cyclin E associated events during G1/S transition
Reactome : DNA Repair
Reactome : Disease
Reactome : Dual incision reaction in GG-NER
Reactome : Dual incision reaction in TC-NER
Reactome : Epigenetic regulation of gene expression
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Formation of incision complex in GG-NER
Reactome : Formation of the Early Elongation Complex
Reactome : Formation of the HIV-1 Early Elongation Complex
Reactome : Formation of transcription-coupled NER (TC-NER) repair complex
Reactome : G1 Phase
Reactome : G1/S Transition
Reactome : G2/M Transition
Reactome : Gene Expression
Reactome : Global Genomic NER (GG-NER)
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : HIV Transcription Initiation
Reactome : Late Phase of HIV Life Cycle
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : Nucleotide Excision Repair
Reactome : RNA Pol II CTD phosphorylation and interaction with CE
Reactome : RNA Polymerase I Chain Elongation
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Promoter Escape
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I Transcription Initiation
Reactome : RNA Polymerase I Transcription Termination
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : RNA Polymerase II HIV Promoter Escape
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Promoter Escape
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : RNA Polymerase II Transcription Initiation
Reactome : RNA Polymerase II Transcription Initiation And Promoter Clearance
Reactome : RNA Polymerase II Transcription Pre-Initiation And Promoter Opening
Reactome : S Phase
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcription-coupled NER (TC-NER)
Reactome : mRNA Capping
WikiPathway : Eukaryotic Transcription Initiation
WikiPathway : G1 to S cell cycle control
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy

Clone

Cloning Information : 136175
HIP Master Clone ID : 87334
Original Clone ID : FLH136175.01L

Organism


TAX_ID : 9606
Species Specific ID: 1022

Genome

Chromosome : 5
Map Location : 5q12.1
Ensembl : ENSG00000134058

Reagents

Labome : cdk7-antibody